TkA01G212220 | RubberDandelionOmics

Gene overview

TkA01G212220

Reference: TK1151 Chr: Chr01 Coordinates: 54047284-54056366 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

8028 bp · TkA01G212220|TK1151|cDNA

GAGATGCGATCAAATCTTTTGAGATGATATATTGATATATGTACAAACGCAGTAAACAAAGGAGTTTAGGTTAGTAGATAAACAAAAACCCTCTGCGCGGGTTTTTCTCCCATCAGCAGTCCCATTATGCACGGACAACCACCGCGCTTCAGCCGTCATGGCGGCGGTAGAGGGCAACCTCCGCCGCAACAGCCATTTCAGCCGTTTATCAACCCTAATTATCTACAAAACAACAACTATTACCTCCAACCTCCAAATTT...

CDS

Download CDS FASTA

7374 bp · TkA01G212220|TK1151|CDS

ATGCACGGACAACCACCGCGCTTCAGCCGTCATGGCGGCGGTAGAGGGCAACCTCCGCCGCAACAGCCATTTCAGCCGTTTATCAACCCTAATTATCTACAAAACAACAACTATTACCTCCAACCTCCAAATTTTCCTATGATGTTTCCTAATTTTCCCGTTGAAACCTCCAACATCCATACCCAAAACCTTAATTTACCCATTGGAAACCCCAACTTCATTACGCAAAACCTCAATATATCCACCGAAAACCCCAACTT...

Protein

Download Protein FASTA

2457 aa · TkA01G212220|TK1151|PROTEIN

MHGQPPRFSRHGGGRGQPPPQQPFQPFINPNYLQNNNYYLQPPNFPMMFPNFPVETSNIHTQNLNLPIGNPNFITQNLNISTENPNFHMQNHRNAPHNQLAYNRVVPHNGANTIEKIDKAVIKARRELIAAGQNVSALKVSQAALVVLQADSWDSLGVQMQHVPCLYRLMLIEGKINAFIHCFVEVWKITTLSDLETAICKNEGVQQFEELELGPLIRHPLINHYFCVNSDSTAVFKISGREILSFLVEYMDTHKGKEVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G212220`
TK1151 ID	TkA01G212220
OH-1004 ID	LXL04_004020
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.100
Protein coverage (%)	TK1151 99.349 / OH-1004 96.643 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G212220

Location Chr01:54047284-54056366 (-)

Description Similar to NOV: Protein NO VEIN

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13750`	Essential protein required for cell fate determination during embryogenesis.	No verified direct reference in this release
`At1g08300`	Protein NO VEIN-LIKE.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004020 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001708 cell fate specification Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0019827 stem cell population maintenance Biological Process

GO:0048364 root development Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G08300

ath:AT4G13750

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.667

Rank 1 · TkA01G212220 · TK1151

Cytoplasm0.301

Rank 2 · TkA01G212220 · TK1151

Cell membrane0.067

Rank 3 · TkA01G212220 · TK1151

Endoplasmic reticulum0.045

Rank 4 · TkA01G212220 · TK1151

Golgi apparatus0.035

Rank 5 · TkA01G212220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25794SACS1059-1075 aa

PF25794SACS1093-1245 aa

PF25794SACS1569-1590 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G212220	`PF25794`	SACS	1059	1075	1e-11	45.8
TkA01G212220	`PF25794`	SACS	1093	1245	1e-11	45.8
TkA01G212220	`PF25794`	SACS	1569	1590	1e-11	45.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JTS8`	Arabidopsis thaliana	sp\|F4JTS8\|NOV_ARATH Protein NO VEIN	45.100%	Swiss-Prot	Medium
`A0A1P8ARG1`	Arabidopsis thaliana	sp\|A0A1P8ARG1\|NVL_ARATH Protein NO VEIN-LIKE	36.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card