TkA01G019170 | RubberDandelionOmics

Gene overview

TkA01G019170

Reference: TK1151 Chr: Chr01 Coordinates: 4899316-4908207 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1453 bp · TkA01G019170|TK1151|cDNA

TGGAAGTTACGTCACCCGGAAATCGGTTGGCATATCAAAATTGTTTCAAAAATCGCAACAATTTAAAACGACGCCTATCTTCGTCCACTTTTCATCCCCTTGAGATCGATTGATATATAGTGAAATCGATTCAAACAGATCTTATTTCCATCAAAGCAATCACAGCGTTTTTTTGCCACTTCATCGCAAATCTTCTTCCTCATGAGTCTTAGTAAAATCGAGAACGAAGGTTCTACCTCAAAGAACTCCGATGCTATTTC...

CDS

Download CDS FASTA

1065 bp · TkA01G019170|TK1151|CDS

ATGAGTCTTAGTAAAATCGAGAACGAAGGTTCTACCTCAAAGAACTCCGATGCTATTTCAGATAGAGAATATTTCGAGCTTTCGGGACCCACACACCTAACTACCATTGACTGGACTAATCCAGATCACAGACGCTCTGTCGCAGCATGCTTAGTCCAAGGCGTATACATCACCGAACGAGACCGCCAAGAAAACCGCCAACCGCCACTCGCGCCGCCATGGTGGCAATCTTTCAACTTCGACATACACAGTCAACTCAT...

Protein

Download Protein FASTA

354 aa · TkA01G019170|TK1151|PROTEIN

MSLSKIENEGSTSKNSDAISDREYFELSGPTHLTTIDWTNPDHRRSVAACLVQGVYITERDRQENRQPPLAPPWWQSFNFDIHSQLIDDADSSIFGTIYKSKNPQSQSTPSYIIAFRGTVTKGNSFSRDLELDIHIIKNGLHQSSRFQIAMQAVKNLVTENKKSNIWLTGHSLGSAMALLTGKKMAKSGILLDSYLFNPPFFSAPLENIKDQNIKHGIRIASSFLTAGLAVAAKIKNANQQNLMPEDSFLALAGWVPCLY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G019170`
TK1151 ID	TkA01G019170
OH-1004 ID	LXL04_005749
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 90.395 / OH-1004 42.440 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G019170

Location Chr01:4899316-4908207 (+)

Description Similar to At4g10955: GDSL esterase/lipase At4g10955

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10955`	GDSL esterase/lipase At4g10955.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005749 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016042 lipid catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT4G10955

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.386

Rank 1 · TkA01G019170 · TK1151

Cytoplasm0.352

Rank 2 · TkA01G019170 · TK1151

Nucleus0.144

Rank 3 · TkA01G019170 · TK1151

Cell membrane0.118

Rank 4 · TkA01G019170 · TK1151

Mitochondrion0.084

Rank 5 · TkA01G019170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12697Abhydrolase_651-76 aa

PF20408Abhydrolase_1155-73 aa

PF26363Phospholipase-like85-179 aa

PF11187Mbeg1-like111-184 aa

PF05728UPF0227141-202 aa

PF01764Lipase_3149-189 aa

PF10230LIDHydrolase149-190 aa

PF20408Abhydrolase_11150-200 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G019170	`PF12697`	Abhydrolase_6	51	76	0.035	15.4
TkA01G019170	`PF20408`	Abhydrolase_11	55	73	0.027	14.9
TkA01G019170	`PF26363`	Phospholipase-like	85	179	1.2e-06	28.7
TkA01G019170	`PF11187`	Mbeg1-like	111	184	0.044	13.9
TkA01G019170	`PF05728`	UPF0227	141	202	0.19	12.3
TkA01G019170	`PF01764`	Lipase_3	149	189	1.1e-08	35.8
TkA01G019170	`PF10230`	LIDHydrolase	149	190	0.055	13.9
TkA01G019170	`PF20408`	Abhydrolase_11	150	200	0.027	14.9
TkA01G019170	`PF12146`	Hydrolase_4	152	187	0.038	14.0
TkA01G019170	`PF12697`	Abhydrolase_6	159	210	0.035	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q680C0`	Arabidopsis thaliana	sp\|Q680C0\|GDL62_ARATH GDSL esterase/lipase At4g10955	56.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card