TkA01G016320 | RubberDandelionOmics

Gene overview

TkA01G016320

Reference: TK1151 Chr: Chr01 Coordinates: 4159899-4163621 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2619 bp · TkA01G016320|TK1151|cDNA

ATAAAAACGATTTATGCGCAATATATTCTTTTCCACATAAGCCCCTCTCACCTCGCGAGTCCCCTCCCGCGCCTCCGCCATTCCCCCACCACCAATCTCCGTCCTCCTGTCGGGACCGCCATAACTGAGCTCTCCACCTAAAAGAATCTATCGACTCTGAAAACCTGTGAACCACCAAAGACATAACAATTGCAGCGTGCAGGAATTGTGACGGATACTTATGAATGGCGTGGAGGGAGCTTGGGAAAAAGAGCATTCGT...

CDS

Download CDS FASTA

1476 bp · TkA01G016320|TK1151|CDS

ATGCCATCTGGCGCCTCCATCACCTTCCTGGACACCCCAGGCCACGCCGCGTTCAGCGCCATGCGTGCACGCGGCGCAGCCGTAACCGACATCGTCGTCCTCGTTGTCGCTGCGGACGACGGTGTCATGCCGCAGACGATCGAGGCGATGGCCCACGCCAGGTCAGCCGACGTCCCGATCGTTGTTGCAATAAATAAATGCGACAAACCTGCGGCAGACCCTAACAGGGTGAAAGTCCAACTGGCGTCTGAAGGACTCCC...

Protein

Download Protein FASTA

491 aa · TkA01G016320|TK1151|PROTEIN

MPSGASITFLDTPGHAAFSAMRARGAAVTDIVVLVVAADDGVMPQTIEAMAHARSADVPIVVAINKCDKPAADPNRVKVQLASEGLPLEEMGGDVQVVEVSAVTKTGLDGLEEALLLQAELMDLKARVDGAAQAYVVEARLDRGRGPLVTALVKAGTLVVGQHIVVGAEWGKIRAIRDTTGKSTNHATPAMPVEIEGLKGLPMAGDDITVVDNEERARMLSVGRKKKMEKDRLRKMNEEKVSGNETVEEGGEGDDVAVVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G016320`
TK1151 ID	TkA01G016320
OH-1004 ID	LXL04_005799
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	96.200
Protein coverage (%)	TK1151 97.352 / OH-1004 67.419 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G016320`
Location	Chr01:4159899-4163621 (+)
Description	Similar to infB: Translation initiation factor IF-2 (Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005799` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005829 cytosol Cellular Component GO:0003743 translation initiation factor activity Molecular Function GO:0003924 GTPase activity Molecular Function GO:0005525 GTP binding Molecular Function
KEGG gene cross-reference	csc:Csac_2070 gox:GOX1582 mpo:Mpop_2819 msl:Msil_2295 pla:Plav_3628 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.630

Rank 1 · TkA01G016320 · TK1151

Nucleus0.317

Rank 2 · TkA01G016320 · TK1151

Mitochondrion0.079

Rank 3 · TkA01G016320 · TK1151

Cell membrane0.078

Rank 4 · TkA01G016320 · TK1151

Endoplasmic reticulum0.069

Rank 5 · TkA01G016320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01926MMR_HSR14-66 aa

PF00009GTP_EFTU6-116 aa

PF03193RsgA_GTPase26-115 aa

PF00025Arf31-111 aa

PF13500AAA_2632-75 aa

PF22042EF-G_D2132-211 aa

PF03144GTP_EFTU_D2146-168 aa

PF22042EF-G_D2220-256 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G016320	`PF01926`	MMR_HSR1	4	66	0.0066	17.3
TkA01G016320	`PF00009`	GTP_EFTU	6	116	3.5e-27	95.9
TkA01G016320	`PF03193`	RsgA_GTPase	26	115	0.017	15.6
TkA01G016320	`PF00025`	Arf	31	111	0.063	13.5
TkA01G016320	`PF13500`	AAA_26	32	75	0.017	15.7
TkA01G016320	`PF22042`	EF-G_D2	132	211	7.2e-21	74.8
TkA01G016320	`PF03144`	GTP_EFTU_D2	146	168	0.0021	19.1
TkA01G016320	`PF22042`	EF-G_D2	220	256	7.2e-21	74.8
TkA01G016320	`PF03144`	GTP_EFTU_D2	224	236	0.0021	19.1
TkA01G016320	`PF11987`	IF-2	260	354	2.4e-27	95.9
TkA01G016320	`PF13500`	AAA_26	326	365	0.017	15.7
TkA01G016320	`PF22042`	EF-G_D2	394	435	7.2e-21	74.8
TkA01G016320	`PF03144`	GTP_EFTU_D2	395	460	0.0021	19.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card