TkA01G003710 | RubberDandelionOmics

Gene overview

TkA01G003710

Reference: TK1151 Chr: Chr01 Coordinates: 981956-984933 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1545 bp · TkA01G003710|TK1151|cDNA

AGATGACTGGGTCGGGTCATAATCGACATTTCGCATACCGTTTGGACGGTGGCCCAATCTCGACCCAAACCATTCGTGAAATTTGCTCCCAGCAACTAGAAGAAAAACTCGATCGATTAGTTTCAGAGGGGAAGATCTCCATGGATGATGATGAAAGAGGACCGAAGTTAAGCAAGAGATTTTCAGACAAAACTGCCGAGGGAGAAGTTGATTACAAAACCAAGTCTGGAACTGCTTGGTCTCACTCTTACCTCAATCAA...

CDS

Download CDS FASTA

1395 bp · TkA01G003710|TK1151|CDS

ATGACTGGGTCGGGTCATAATCGACATTTCGCATACCGTTTGGACGGTGGCCCAATCTCGACCCAAACCATTCGTGAAATTTGCTCCCAGCAACTAGAAGAAAAACTCGATCGATTAGTTTCAGAGGGGAAGATCTCCATGGATGATGATGAAAGAGGACCGAAGTTAAGCAAGAGATTTTCAGACAAAACTGCCGAGGGAGAAGTTGATTACAAAACCAAGTCTGGAACTGCTTGGTCTCACTCTTACCTCAATCAAAA...

Protein

Download Protein FASTA

464 aa · TkA01G003710|TK1151|PROTEIN

MTGSGHNRHFAYRLDGGPISTQTIREICSQQLEEKLDRLVSEGKISMDDDERGPKLSKRFSDKTAEGEVDYKTKSGTAWSHSYLNQKPWHPLSYPNQRRKWIAEQTHAQQERRAEEVAREYAQEQEFFRQAALVSRKEKEKMEMMKAVSFMYVRPPGYNPESAKAAEIAEENKTQEPSHDPHSEDTEAPQMPQNPNPPDDQKKKKRPKDVFGRVLPTEEQFEALKNAPKLETGVAGRARPFGIEIRNVKCVRCGSFGHQS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G003710`
TK1151 ID	TkA01G003710
OH-1004 ID	LXL04_005971
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G003710

Location Chr01:981956-984933 (-)

Description Similar to At4g19190: Uncharacterized zinc finger CCHC domain-containing protein At4g19190

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g19190`	Uncharacterized zinc finger CCHC domain-containing protein At4g19190.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005971 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0005634 nucleus Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005813 centrosome Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0032991 protein-containing complex Cellular Component

KEGG gene cross-reference

ath:AT4G19190

gga:426529

hsa:9541

mmu:66935

rno:362149

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.951

Rank 1 · TkA01G003710 · TK1151

Cytoplasm0.150

Rank 2 · TkA01G003710 · TK1151

Cell membrane0.024

Rank 3 · TkA01G003710 · TK1151

Mitochondrion0.017

Rank 4 · TkA01G003710 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA01G003710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10197Cir_N89-124 aa

PF15288zf-CCHC_6132-141 aa

PF10197Cir_N137-143 aa

PF29676Saf6_C159-175 aa

PF10197Cir_N167-176 aa

PF15288zf-CCHC_6248-269 aa

PF29676Saf6_C326-419 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G003710	`PF10197`	Cir_N	89	124	2e-10	41.4
TkA01G003710	`PF15288`	zf-CCHC_6	132	141	8.4e-06	26.3
TkA01G003710	`PF10197`	Cir_N	137	143	2e-10	41.4
TkA01G003710	`PF29676`	Saf6_C	159	175	3.7	7.4
TkA01G003710	`PF10197`	Cir_N	167	176	2e-10	41.4
TkA01G003710	`PF15288`	zf-CCHC_6	248	269	8.4e-06	26.3
TkA01G003710	`PF29676`	Saf6_C	326	419	3.7	7.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZ67`	Arabidopsis thaliana	sp\|Q8VZ67\|Y4919_ARATH Uncharacterized zinc finger CCHC domain-containing protein At4g19190	69.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card