TkA01G002780 | RubberDandelionOmics

Gene overview

TkA01G002780

Reference: TK1151 Chr: Chr01 Coordinates: 723940-726184 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1966 bp · TkA01G002780|TK1151|cDNA

TAAACATTTAAAATTGCTTTAAACTGGCAAAAAAGAAAGTGGAATTTTAGAGTGTGGTGAATATGAAAAACGGCAAATAAATGTCCCAAGGTTAAGTTGGTTGGCAAATAAGAACCCAAGGCTCCGCTCCACACAAATAATACCACCCTCATCCTCAATCAACCAATACCTTAATGCCACATGGCATCACAAATATCCAAACTGCATCAAATAACAACCAAGCTTCTCCATGCCTATTGTTATCACAAATGCCATCACCT...

CDS

Download CDS FASTA

1221 bp · TkA01G002780|TK1151|CDS

ATGGCAGTGTCGACAGTGTACACAGTCCAATCTTTGAACTCAACATGTTCATCAATCTCAGCACCCACCTCCAAATCTAGAACCTATTTCGGGATCCAACAAAGACAGGTTCTGTTGTACACGAAAAAGACATCCAGGGGCAGGGTGAGAAGTGGCGAGATAAGATGTTCCGGGGACACAATCGTAATTGGACTGGCAGCCGACTCAGGGTGCGGGAAGAGTACTTTCATGAGGAGGTTGACTAGCGTGTTCGGAGGTGC...

Protein

Download Protein FASTA

406 aa · TkA01G002780|TK1151|PROTEIN

MAVSTVYTVQSLNSTCSSISAPTSKSRTYFGIQQRQVLLYTKKTSRGRVRSGEIRCSGDTIVIGLAADSGCGKSTFMRRLTSVFGGAAEPPKGGNPDSNTLISDTTTVICLDDYHSLDRTGRKVEGVTALDPRANNFDLMYEQVKALKDGIAVDKPIYNHVSGLLDPPELIKPPKILVIEGLHPMYDQRVRDLLDFSIYLDISDDVKFAWKIQRDMAERGHSLESIKASIEARKPDFDAYIDPQKQYADAVIEVLPTQLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G002780`
TK1151 ID	TkA01G002780
OH-1004 ID	LXL04_029221
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	72.400
Protein coverage (%)	TK1151 56.404 / OH-1004 92.857 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G002780

Location Chr01:723940-726184 (+)

Description Similar to Phosphoribulokinase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32060`	Phosphoribulokinase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029221 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0019253 reductive pentose-phosphate cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0010319 stromule Cellular Component

GO:0048046 apoplast Cellular Component

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G32060

cre:CHLRE_12g554800v5

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.978

Rank 1 · TkA01G002780 · TK1151

Mitochondrion0.035

Rank 2 · TkA01G002780 · TK1151

Cytoplasm0.024

Rank 3 · TkA01G002780 · TK1151

Nucleus0.020

Rank 4 · TkA01G002780 · TK1151

Peroxisome0.017

Rank 5 · TkA01G002780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08955BofC_C21-43 aa

PF00485PRK62-260 aa

PF08955BofC_C139-154 aa

PF00485PRK275-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G002780	`PF08955`	BofC_C	21	43	0.23	12.4
TkA01G002780	`PF00485`	PRK	62	260	9.7e-80	267.7
TkA01G002780	`PF08955`	BofC_C	139	154	0.23	12.4
TkA01G002780	`PF00485`	PRK	275	296	9.7e-80	267.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P25697`	Arabidopsis thaliana	sp\|P25697\|KPPR_ARATH Phosphoribulokinase, chloroplastic	83.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card