TkA01G001000 | RubberDandelionOmics

Gene overview

TkA01G001000

Reference: TK1151 Chr: Chr01 Coordinates: 204856-207039 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2084 bp · TkA01G001000|TK1151|cDNA

AGGGAACAAAACTAGAAAATAAATTAATTTTCGTGATTTTCTTTTGTAAAAATAAAAAACTCCAAACCCATTCAGCCATTCTGACCCAAATAAAACAAAGCACAAAAATTCAAAATCTGCAGCATCTCCTGCTCCGTACATATGCTCCCTCCCCCAAAGCTCTGCATCCATCTCCACCCACTACACACATTTCCCAACGTTCTCTTCGATCCACATTCCACAGACATACACTTCGTTTCTTCATTCACCAGCTAGTGGAC...

CDS

Download CDS FASTA

1272 bp · TkA01G001000|TK1151|CDS

ATGGAAGGTGCGATTACATCTACAAAACCTTCATCAAACATTTCAGAAATCGTTTCCAAATTCGCTAAAGTCTGCAAGTTCCGATCGATCGGTGTATTCTCCTCTGAAAACCCGAATCATCTTCAGCATCACGAATCCTCCAATGACGTATTCGAACGTGTTAATGGAGTCGAAGTTTTTCCTGACCTAGTTGAGGTGTGCAGTAAAAGCAGCTGGTGTGGCCATGAAGAGATCTCGAAGCTGTTCGACATAATGTCTGA...

Protein

Download Protein FASTA

423 aa · TkA01G001000|TK1151|PROTEIN

MEGAITSTKPSSNISEIVSKFAKVCKFRSIGVFSSENPNHLQHHESSNDVFERVNGVEVFPDLVEVCSKSSWCGHEEISKLFDIMSELKLAYVQLQEAHIPYDPDKIKAADELVFSNLDGLCKVRRSFKEKQFQKSNSLSACLTVLRTETKVQERSLERLKSQAKKKDLEITHLKSQLHDLDTKNKAIIEEIKLKKREAIKRLNLTSIDKIITEVSKSIHDFAKPLIAFMKASEWDLDEAANSIQDSVTYTVRSHKKYAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G001000`
TK1151 ID	TkA01G001000
OH-1004 ID	LXL04_010487
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	37.900
Protein coverage (%)	TK1151 80.142 / OH-1004 88.915 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G001000

Location Chr01:204856-207039 (+)

Description Similar to GIL1: Protein GRAVITROPIC IN THE LIGHT 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58960`	Required for red (R) and far red (FR) light-induced and phytochrome-mediated deregulation of negative gravitropism leading to randomization of hypocotyl growth orientation.	Phytochrome-mediated agravitropism in Arabidopsis hypocotyls requires GIL1 and confers a fitness advantage.2006 · DOI: 10.1111/j.1365-313x.2006.02727.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010487 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009639 response to red or far red light Biological Process

GO:0009959 negative gravitropism Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G12900

ath:AT5G58960

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.603

Rank 1 · TkA01G001000 · TK1151

Nucleus0.390

Rank 2 · TkA01G001000 · TK1151

Cell membrane0.143

Rank 3 · TkA01G001000 · TK1151

Endoplasmic reticulum0.059

Rank 4 · TkA01G001000 · TK1151

Lysosome / Vacuole0.042

Rank 5 · TkA01G001000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04859DUF64175-188 aa

PF05082Rop-like80-96 aa

PF22813TcaA_2nd137-181 aa

PF27482Beta-prop_YycP146-222 aa

PF05082Rop-like156-181 aa

PF22813TcaA_2nd198-263 aa

PF05082Rop-like211-221 aa

PF24994GIL1_IRKI_C244-252 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G001000	`PF04859`	DUF641	75	188	3.8e-29	102.3
TkA01G001000	`PF05082`	Rop-like	80	96	9.5	6.9
TkA01G001000	`PF22813`	TcaA_2nd	137	181	0.25	12.4
TkA01G001000	`PF27482`	Beta-prop_YycP	146	222	0.006	16.4
TkA01G001000	`PF05082`	Rop-like	156	181	9.5	6.9
TkA01G001000	`PF22813`	TcaA_2nd	198	263	0.25	12.4
TkA01G001000	`PF05082`	Rop-like	211	221	9.5	6.9
TkA01G001000	`PF24994`	GIL1_IRKI_C	244	252	1.3e-11	45.0
TkA01G001000	`PF24994`	GIL1_IRKI_C	366	418	1.3e-11	45.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KGE8`	Arabidopsis thaliana	sp\|F4KGE8\|GIL1_ARATH Protein GRAVITROPIC IN THE LIGHT 1	29.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card