LXL04_039376 | RubberDandelionOmics

Gene overview

LXL04_039376

Reference: OH-1004 Chr: JAJTUU010000010.1 Coordinates: 5344012-5348986 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1773 bp · LXL04_039376|LXL04_039376|OH1004|cDNA

ATGAGGAAAGAACACTTAAAGCTCAGATTAGATACAAGTTTTGTCATTATTTATGAATCTAATTCTCCATTTTCAGGCAGTATGTGCGATGATGTGGATCAACAGCAGGTTTGGTACAACAGTGAGGCACTTCTCTCGAGTGTCTCCTCCACAGGAACTGACTGTTTAGTGCGGGTTTCATCTAAAAacataactcatttgggtcgCCCTAAATCCGGTCACAAGCCTCGTCAGCTTTTATCCTTGCCCCCATTTCCACC...

CDS

Download CDS FASTA

1773 bp · LXL04_039376|LXL04_039376|OH1004|CDS

ATGAGGAAAGAACACTTAAAGCTCAGATTAGATACAAGTTTTGTCATTATTTATGAATCTAATTCTCCATTTTCAGGCAGTATGTGCGATGATGTGGATCAACAGCAGGTTTGGTACAACAGTGAGGCACTTCTCTCGAGTGTCTCCTCCACAGGAACTGACTGTTTAGTGCGGGTTTCATCTAAAAACATAACTCATTTGGGTCGCCCTAAATCCGGTCACAAGCCTCGTCAGCTTTTATCCTTGCCCCCATTTCCACC...

Protein

Download Protein FASTA

590 aa · LXL04_039376|LXL04_039376|OH1004|PROTEIN

MRKEHLKLRLDTSFVIIYESNSPFSGSMCDDVDQQQVWYNSEALLSSVSSTGTDCLVRVSSKNITHLGRPKSGHKPRQLLSLPPFPPHPPPGKNGPPDSRMTSISWMKYYFADVTASLIQSHFNKGLVRLCSASSQQATKGAIKGWGNVAVHNSMDALAAAALCYDYDEGPKLACSDRCEPTTYQRYWALVIGTPKEKQGLISAPLTKVVLNGGKAERVMLGYGSGGVEEAVTEYRVLGPTINGCSWVELRPLTNHKHQM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039376`
TK1151 ID	TkA01G005180
OH-1004 ID	LXL04_039376
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	70.100
Protein coverage (%)	TK1151 85.405 / OH-1004 34.576 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039376

Location JAJTUU010000010.1:5344012-5348986 (-)

Description Similar to At1g78910: RNA pseudouridine synthase 3, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78910`	RNA pseudouridine synthase 3, mitochondrial.	No verified direct reference in this release
`At3g19440`	RNA pseudouridine synthase 4, mitochondrial.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0520100`	RNA pseudouridine synthase 3, mitochondrial.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039376 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000455 enzyme-directed rRNA pseudouridine synthesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0009982 pseudouridine synthase activity Molecular Function

KEGG gene cross-reference

ath:AT1G78910

ath:AT3G19440

dosa:Os08g0520100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.565

Rank 1 · LXL04_039376 · OH-1004

Cytoplasm0.319

Rank 2 · LXL04_039376 · OH-1004

Cell membrane0.083

Rank 3 · LXL04_039376 · OH-1004

Mitochondrion0.066

Rank 4 · LXL04_039376 · OH-1004

Endoplasmic reticulum0.064

Rank 5 · LXL04_039376 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00849.28PseudoU_synth_2186-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039376	`PF00849.28`	PseudoU_synth_2	186	265	3.4e-06	28.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XET6`	Arabidopsis thaliana	RNA pseudouridine synthase 3, mitochondrial	59.336%	Swiss-Prot	weak database homology
`Q9LT72`	Arabidopsis thaliana	RNA pseudouridine synthase 4, mitochondrial	40.254%	Swiss-Prot	weak database homology
`Q0J4D4`	Oryza sativa subsp. japonica	RNA pseudouridine synthase 3, mitochondrial	61.277%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card