LXL04_035768 | RubberDandelionOmics

Gene overview

LXL04_035768

Reference: OH-1004 Chr: Chr08 Coordinates: 28542510-28544198 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1656 bp · LXL04_035768|LXL04_035768|OH1004|cDNA

ATGATATCAGAAAATCCAACAAATGAAACATCATCACTTCATCAAGAACTCGAAGTACTAACCGTATCAAAACGTCTTGTAAGAAGCCTAAGCCAAAAACTAAAAAGAAAAAACCAAAGCAGTACACCCGATGACGTGGACAACACACGTGGCGTTTCAATAAAATGCCCCACCCGTGGCGGCGGCTGCAAGGTCGGAGCCACCACCGGAGACGAATTCTCCGATTGCCGGGGCCGCCCTTCAACTTCCAATGACTATAA...

CDS

Download CDS FASTA

1656 bp · LXL04_035768|LXL04_035768|OH1004|CDS

ATGATATCAGAAAATCCAACAAATGAAACATCATCACTTCATCAAGAACTCGAAGTACTAACCGTATCAAAACGTCTTGTAAGAAGCCTAAGCCAAAAACTAAAAAGAAAAAACCAAAGCAGTACACCCGATGACGTGGACAACACACGTGGCGTTTCAATAAAATGCCCCACCCGTGGCGGCGGCTGCAAGGTCGGAGCCACCACCGGAGACGAATTCTCCGATTGCCGGGGCCGCCCTTCAACTTCCAATGACTATAA...

Protein

Download Protein FASTA

551 aa · LXL04_035768|LXL04_035768|OH1004|PROTEIN

MISENPTNETSSLHQELEVLTVSKRLVRSLSQKLKRKNQSSTPDDVDNTRGVSIKCPTRGGGCKVGATTGDEFSDCRGRPSTSNDYKPVCGPDDTTIDCFSYGVKERFWKRSNNRKITEMENTHQHVLFLPDDIVEMCLVKLPLTSLVRARLVCKKWKVLTSTPRFLEMRRENGYQTPWLFLFGCVKNGICSKEINAFDVSSNKWHKIESEILKGRFMFSVVNIRDDVYIVGGCSSLTNFGRVDRSSVKTHKGVLVFSPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035768`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035768

Location Chr08:28542510-28544198 (-)

Description Similar to At5g42350: F-box/kelch-repeat protein At5g42350

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42350`	F-box/kelch-repeat protein At5g42350.	No verified direct reference in this release
`At5g42360`	F-box/kelch-repeat protein At5g42360.	No verified direct reference in this release
`At1g30090`	F-box/kelch-repeat protein At1g30090.	No verified direct reference in this release
`At5g15710`	F-box/kelch-repeat protein At5g15710.	No verified direct reference in this release
`At2g24540`	Component of SCF (ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035768 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001558 regulation of cell growth Biological Process

GO:0008361 regulation of cell size Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0019005 SCF ubiquitin ligase complex Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G30090

ath:AT2G24540

ath:AT5G15710

ath:AT5G42350

ath:AT5G42360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.712

Rank 1 · LXL04_035768 · OH-1004

Cytoplasm0.245

Rank 2 · LXL04_035768 · OH-1004

Cell membrane0.071

Rank 3 · LXL04_035768 · OH-1004

Endoplasmic reticulum0.042

Rank 4 · LXL04_035768 · OH-1004

Mitochondrion0.034

Rank 5 · LXL04_035768 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937.13F-box-like129-164 aa

PF00646.39F-box130-167 aa

PF24681.2Kelch_KLHDC2_KLHL20_DRC7153-233 aa

PF01344.32Kelch_1216-271 aa

PF01344.32Kelch_1355-386 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035768	`PF12937.13`	F-box-like	129	164	4.8e-06	27.0
LXL04_035768	`PF00646.39`	F-box	130	167	1.1e-08	35.4
LXL04_035768	`PF24681.2`	Kelch_KLHDC2_KLHL20_DRC7	153	233	7.8e-10	39.1
LXL04_035768	`PF01344.32`	Kelch_1	216	271	6e-13	48.8
LXL04_035768	`PF01344.32`	Kelch_1	355	386	6e-13	48.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FII2`	Arabidopsis thaliana	F-box/kelch-repeat protein At5g42350	52.431%	Swiss-Prot	strong database homology
`Q9FII1`	Arabidopsis thaliana	F-box/kelch-repeat protein At5g42360	52.513%	Swiss-Prot	strong database homology
`Q9C6Z0`	Arabidopsis thaliana	F-box/kelch-repeat protein At1g30090	35.714%	Swiss-Prot	weak database homology
`Q9LFV5`	Arabidopsis thaliana	F-box/kelch-repeat protein At5g15710	24.719%	Swiss-Prot	weak database homology
`Q8LAW2`	Arabidopsis thaliana	F-box protein AFR	25.316%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card