LXL04_035567 | RubberDandelionOmics

Gene overview

LXL04_035567

Reference: OH-1004 Chr: Chr08 Coordinates: 24731955-24736421 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1914 bp · LXL04_035567|LXL04_035567|OH1004|cDNA

ATGGCTCTTTTACGACTTCGACATCATCCGGTGATCTCACGAGCACCTTCGCTACTTAGGGCTCGCCTCCTTTCTTCCACCTCCAGATCCATTTCCCGCTATTCCAGATTGCAGAATTCCATACTCGATGATGGTGGCACTTTGTTAAGGCCCAAACTTTTTTCTGCATTCAATGGCGTCCATGACCATTCTACACTAAAGTCTCTGAGTGGTATCAGATGCTACTCATCTGCAGAACCCCCTGCACAtatagtgattgg...

CDS

Download CDS FASTA

1914 bp · LXL04_035567|LXL04_035567|OH1004|CDS

ATGGCTCTTTTACGACTTCGACATCATCCGGTGATCTCACGAGCACCTTCGCTACTTAGGGCTCGCCTCCTTTCTTCCACCTCCAGATCCATTTCCCGCTATTCCAGATTGCAGAATTCCATACTCGATGATGGTGGCACTTTGTTAAGGCCCAAACTTTTTTCTGCATTCAATGGCGTCCATGACCATTCTACACTAAAGTCTCTGAGTGGTATCAGATGCTACTCATCTGCAGAACCCCCTGCACATATAGTGATTGG...

Protein

Download Protein FASTA

637 aa · LXL04_035567|LXL04_035567|OH1004|PROTEIN

MALLRLRHHPVISRAPSLLRARLLSSTSRSISRYSRLQNSILDDGGTLLRPKLFSAFNGVHDHSTLKSLSGIRCYSSAEPPAHIVIGMPALSPTMTQGNIAKWWKKEGDKIEVGDIICEIETDKATLEFESLEEGFLAKILVPAGAKDVPVGQPIAITVEEAENLHNIPDSVLGGSEVKETESTQANVKTEDTVTESTSGKVDASNLPPHILIEMPALSPTMDQGNIARWLKKEGDKIEVGDIICEIETDKATLEFECLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035567`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035567

Location Chr08:24731955-24736421 (-)

Description Similar to LTA3: Dihydrolipoyllysine-residue acetyltransferase component 1 of pyruvate dehydrogenase complex, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52200`	The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035567 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006006 glucose metabolic process Biological Process

GO:0006086 pyruvate decarboxylation to acetyl-CoA Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0042867 pyruvate catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0045254 pyruvate dehydrogenase complex Cellular Component

GO:0120212 sperm head-tail coupling apparatus Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0004742 dihydrolipoyllysine-residue acetyltransferase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G52200

bta:512723

hsa:1737

mmu:235339

rno:81654

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.807

Rank 1 · LXL04_035567 · OH-1004

Plastid0.091

Rank 2 · LXL04_035567 · OH-1004

Cytoplasm0.089

Rank 3 · LXL04_035567 · OH-1004

Peroxisome0.053

Rank 4 · LXL04_035567 · OH-1004

Nucleus0.038

Rank 5 · LXL04_035567 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00364.29Biotin_lipoyl86-156 aa

PF00364.29Biotin_lipoyl213-283 aa

PF00198.292-oxoacid_dh406-637 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035567	`PF00364.29`	Biotin_lipoyl	86	156	1.1e-35	122.0
LXL04_035567	`PF00364.29`	Biotin_lipoyl	213	283	1.1e-35	122.0
LXL04_035567	`PF00198.29`	2-oxoacid_dh	406	637	5e-74	249.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WQF7`	Arabidopsis thaliana	Dihydrolipoyllysine-residue acetyltransferase component 1 of pyruvate dehydrogenase complex, mitochondrial	61.059%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card