LXL04_034976 | RubberDandelionOmics

Gene overview

LXL04_034976

Reference: OH-1004 Chr: Chr08 Coordinates: 8418116-8419842 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1248 bp · LXL04_034976|LXL04_034976|OH1004|cDNA

ATGGAACCCATTCCGAACGGCAACTCCGCCGTCGCCAGCGCCACGGTGTCCTCATCCACCGCCACATCCCTCGCATCAGTTAACGGTGAAGTTTCATCTTCAAAACTCACGCAACTGACGGAGTCCCTAAAACTAGAACATCAGTTCCTTAGAGTACCATTCGAACACTACAAGAAGACGATCCGCGCCAACCACAGGGTCGTCGAGAAAGAGGTCTCCGCCGTCATGTCCAGCCTTTCAGATGCCGGTGATCTCTCCCA...

CDS

Download CDS FASTA

1248 bp · LXL04_034976|LXL04_034976|OH1004|CDS

ATGGAACCCATTCCGAACGGCAACTCCGCCGTCGCCAGCGCCACGGTGTCCTCATCCACCGCCACATCCCTCGCATCAGTTAACGGTGAAGTTTCATCTTCAAAACTCACGCAACTGACGGAGTCCCTAAAACTAGAACATCAGTTCCTTAGAGTACCATTCGAACACTACAAGAAGACGATCCGCGCCAACCACAGGGTCGTCGAGAAAGAGGTCTCCGCCGTCATGTCCAGCCTTTCAGATGCCGGTGATCTCTCCCA...

Protein

Download Protein FASTA

415 aa · LXL04_034976|LXL04_034976|OH1004|PROTEIN

MEPIPNGNSAVASATVSSSTATSLASVNGEVSSSKLTQLTESLKLEHQFLRVPFEHYKKTIRANHRVVEKEVSAVMSSLSDAGDLSQDDAVKHLNSLVFRLQGLKRKLEDGSRAENLQAQRCRARLDHLESAGADNISEWNNTRLKRILVDYMLRMSYYNTATKLAERSNIQDLVDIEIFYEAKKVIDALRNKEVAPALAWCADNKSRLKKSKSKFEFQLRLQEFIELVRSENNFQAVMYARKYLAPWAATYMKELQKVF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034976`
TK1151 ID	TkA04G197320
OH-1004 ID	LXL04_034976
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034976

Location Chr08:8418116-8419842 (-)

Description Similar to MAEA: Protein MAEA homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55070`	Protein MAEA homolog.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034976 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0051301 cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016363 nuclear matrix Cellular Component

GO:0034657 GID complex Cellular Component

GO:0003779 actin binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT3G55070

dre:321575

pon:100173862

xla:443783

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.594

Rank 1 · LXL04_034976 · OH-1004

Nucleus0.415

Rank 2 · LXL04_034976 · OH-1004

Lysosome / Vacuole0.054

Rank 3 · LXL04_034976 · OH-1004

Golgi apparatus0.050

Rank 4 · LXL04_034976 · OH-1004

Mitochondrion0.042

Rank 5 · LXL04_034976 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10607.15CTLH180-320 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034976	`PF10607.15`	CTLH	180	320	8.6e-47	159.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2V9`	Arabidopsis thaliana	Protein MAEA homolog	70.714%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card