LXL04_033684 | RubberDandelionOmics

Gene overview

LXL04_033684

Reference: OH-1004 Chr: Chr07 Coordinates: 53058761-53060549 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1440 bp · LXL04_033684|LXL04_033684|OH1004|cDNA

ATGGATGAAGTACTTGTGAACTTTGAAAGCAAGTCACATGTGGTGTTCGTACCATTCCCAGCACAAAGCCACATCAAGTGTATGCTAAAACTAGCAAGGCTACTCCATCACAAGGGCCTTCACATAACCTTTGTCAACACTGAAGTTAACCACAACCAGTTACTTAACTCTGGTGGGCTAAACAGTCTGGATGATGAACCAGGGTTCCAGTTCAAGACCATTCCCGATGGTGTTCCTGAGGGTGCACCGGAGTACATGAA...

CDS

Download CDS FASTA

1440 bp · LXL04_033684|LXL04_033684|OH1004|CDS

ATGGATGAAGTACTTGTGAACTTTGAAAGCAAGTCACATGTGGTGTTCGTACCATTCCCAGCACAAAGCCACATCAAGTGTATGCTAAAACTAGCAAGGCTACTCCATCACAAGGGCCTTCACATAACCTTTGTCAACACTGAAGTTAACCACAACCAGTTACTTAACTCTGGTGGGCTAAACAGTCTGGATGATGAACCAGGGTTCCAGTTCAAGACCATTCCCGATGGTGTTCCTGAGGGTGCACCGGAGTACATGAA...

Protein

Download Protein FASTA

479 aa · LXL04_033684|LXL04_033684|OH1004|PROTEIN

MDEVLVNFESKSHVVFVPFPAQSHIKCMLKLARLLHHKGLHITFVNTEVNHNQLLNSGGLNSLDDEPGFQFKTIPDGVPEGAPEYMNEVCRSILNKFLDPFVDLMERLESSVNCVIADGMMPFTVDAAEKFRVPIMHFWTFSASAFMGYYQAPNLIEKGLIPLKDESCFTNGYLETVIDGIPELEGFRLKDLPGYIRTTNSNSEEYTYVIESIKATRKVSNVILHTFNELESTIIKALEPMIPHIYTIGPLELLLNSTKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033684`
TK1151 ID	TkA08G299330
OH-1004 ID	LXL04_033684
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	94.300
Protein coverage (%)	TK1151 100.000 / OH-1004 29.228 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033684

Location Chr07:53058761-53060549 (-)

Description Similar to UGT85C2: UDP-glycosyltransferase 85C2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22380`	UDP-glycosyltransferase 85A3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033684 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

GO:0015020 glucuronosyltransferase activity Molecular Function

GO:0035251 UDP-glucosyltransferase activity Molecular Function

GO:0080043 quercetin 3-O-glucosyltransferase activity Molecular Function

GO:0080044 quercetin 7-O-glucosyltransferase activity Molecular Function

GO:0102377 steviol 13-O glucosyltransferase activity Molecular Function

GO:0102378 steviolmonoside glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ag:ABV68925

ag:BAK55737

ath:AT1G22380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.736

Rank 1 · LXL04_033684 · OH-1004

Nucleus0.186

Rank 2 · LXL04_033684 · OH-1004

Endoplasmic reticulum0.087

Rank 3 · LXL04_033684 · OH-1004

Peroxisome0.069

Rank 4 · LXL04_033684 · OH-1004

Plastid0.051

Rank 5 · LXL04_033684 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168.1Glyco_transf_N13-130 aa

PF00201.25UDPGT281-440 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033684	`PF26168.1`	Glyco_transf_N	13	130	4e-08	34.2
LXL04_033684	`PF00201.25`	UDPGT	281	440	2.6e-19	70.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMF1`	Arabidopsis thaliana	UDP-glycosyltransferase 85A3	49.174%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card