LXL04_029571 | RubberDandelionOmics

Gene overview

LXL04_029571

Reference: OH-1004 Chr: Chr06 Coordinates: 94464106-94465885 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

924 bp · LXL04_029571|LXL04_029571|OH1004|cDNA

ATGGAGTCTCCTTCATCGGCCATTAGAGCAACGAAGCCAAACCCTAAGTCGCCATCTCCCGccgccaccaccacctccaACCATCTCGTGCCAGTCGTCGGTTCAACGGCCACCCTACAACGTCGACCATCATCCGCAAGAGAGAGAGACGAAAGCGAGAGGAACAGGGAAGAACCGGCAGGCCTGGTTTCTCCTTCGATCGGCCATGGATGTCGAGGAAGGTCACGGTGGAACAAGGCATCGACGAACTTCACTTTCTC...

CDS

Download CDS FASTA

924 bp · LXL04_029571|LXL04_029571|OH1004|CDS

ATGGAGTCTCCTTCATCGGCCATTAGAGCAACGAAGCCAAACCCTAAGTCGCCATCTCCCGCCGCCACCACCACCTCCAACCATCTCGTGCCAGTCGTCGGTTCAACGGCCACCCTACAACGTCGACCATCATCCGCAAGAGAGAGAGACGAAAGCGAGAGGAACAGGGAAGAACCGGCAGGCCTGGTTTCTCCTTCGATCGGCCATGGATGTCGAGGAAGGTCACGGTGGAACAAGGCATCGACGAACTTCACTTTCTC...

Protein

Download Protein FASTA

307 aa · LXL04_029571|LXL04_029571|OH1004|PROTEIN

MESPSSAIRATKPNPKSPSPAATTTSNHLVPVVGSTATLQRRPSSARERDESERNREEPAGLVSPSIGHGCRGRSRWNKASTNFTFSIAQFSTDRNLMFEALILPIEASIRPPPIGHQNRIRSKNPTVFQLIRHPPIPEKGMKTRNQAKRPRLSYGENGTISEAGDDPKANGNVCHFLSLQCTVIYNKIRRIYYYILFLEHPYLLFLLENSTPMEAKSELEDEMGYIINHQTLACVQNLLTNNIKRRIKKEACWTISNLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029571`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029571

Location Chr06:94464106-94465885 (+)

Description Similar to Os05g0155601: Importin subunit alpha-1b

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02150`	Binds to conventional NLS motifs and mediates nuclear protein import across the nuclear envelope (By similarity).	An importin alpha homolog, MOS6, plays an important role in plant innate immunity.2005 · DOI: 10.1016/j.cub.2005.05.022
`At3g06720`	Binds to conventional NLS motifs with high affinity in the absence of an importin beta subunit.	SWO1 modulates cell wall integrity under salt stress by interacting with importin ɑ in Arabidopsis.2021 · DOI: 10.1007/s44154-021-00010-5

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0155601`	Functions in nuclear protein import.	No verified direct reference in this release
`Os01g0253300`	Functions in nuclear protein import.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029571 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006606 protein import into nucleus Biological Process

GO:0006607 NLS-bearing protein import into nucleus Biological Process

GO:0006952 defense response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0071555 cell wall organization Biological Process

GO:2000280 regulation of root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0042564 NLS-dependent protein nuclear import complex Cellular Component

KEGG gene cross-reference

ath:AT3G06720

ath:AT4G02150

sly:543535

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.491

Rank 1 · LXL04_029571 · OH-1004

Cytoplasm0.362

Rank 2 · LXL04_029571 · OH-1004

Cell membrane0.123

Rank 3 · LXL04_029571 · OH-1004

Mitochondrion0.091

Rank 4 · LXL04_029571 · OH-1004

Endoplasmic reticulum0.069

Rank 5 · LXL04_029571 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04294`	Arabidopsis thaliana	Importin subunit alpha-3	36.842%	Swiss-Prot	weak database homology
`Q96321`	Arabidopsis thaliana	Importin subunit alpha-1	66.667%	Swiss-Prot	weak database homology
`Q9SLX0`	Oryza sativa subsp. japonica	Importin subunit alpha-1b	73.810%	Swiss-Prot	weak database homology
`Q71VM4`	Oryza sativa subsp. japonica	Importin subunit alpha-1a	48.052%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card