LXL04_026658 | RubberDandelionOmics

Gene overview

LXL04_026658

Reference: OH-1004 Chr: Chr06 Coordinates: 1031744-1034200 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1707 bp · LXL04_026658|LXL04_026658|OH1004|cDNA

ATGAGAGGTGGGAATTTGGATCTGTTCGATCCCAGGACTGCTGTCATGGACTCTTCTGACTATACTATCGAAGTCGGTCGTGGTGACGGCGACTTCGGTTTTGCCTTCAACGATAGCAATTTCTCCGATCGCATTCTGCGCATAGAAATCATTTCCGAATCCACAGAGGCTAGGTCTGATGGCGAAGGTTGCACAAGTCTTGCCGATTGGGCCAGAAATCGGAAACGCCGGAGAGAAGATATCAAAAGAGAGAATGGTAA...

CDS

Download CDS FASTA

1707 bp · LXL04_026658|LXL04_026658|OH1004|CDS

ATGAGAGGTGGGAATTTGGATCTGTTCGATCCCAGGACTGCTGTCATGGACTCTTCTGACTATACTATCGAAGTCGGTCGTGGTGACGGCGACTTCGGTTTTGCCTTCAACGATAGCAATTTCTCCGATCGCATTCTGCGCATAGAAATCATTTCCGAATCCACAGAGGCTAGGTCTGATGGCGAAGGTTGCACAAGTCTTGCCGATTGGGCCAGAAATCGGAAACGCCGGAGAGAAGATATCAAAAGAGAGAATGGTAA...

Protein

Download Protein FASTA

568 aa · LXL04_026658|LXL04_026658|OH1004|PROTEIN

MRGGNLDLFDPRTAVMDSSDYTIEVGRGDGDFGFAFNDSNFSDRILRIEIISESTEARSDGEGCTSLADWARNRKRRREDIKRENGNSLCFLKVLKSTAFTAVDMAGGPEEQILNQPDNIPDDADTENQDEETAAMIEEPPSGDEGANDNDSNWSMECSTVVRVKTLHISSPILAAKSPFFYKLFSNGMRESEQRHVILRINASEEAALMELLNFMYSNTLTATTAPALLDVLMAADKFEVASCMRYCSRALRNLPMTPE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026658`
TK1151 ID	TkA07G000110
OH-1004 ID	LXL04_026658
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026658

Location Chr06:1031744-1034200 (+)

Description Similar to POB1: BTB/POZ domain-containing protein POB1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61600`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At2g46260`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At4g01160`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026658 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0006513 protein monoubiquitination Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010114 response to red light Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005819 spindle Cellular Component

GO:0005829 cytosol Cellular Component

GO:0031463 Cul3-RING ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT2G46260

ath:AT3G61600

ath:AT4G01160

dre:559380

hsa:84541

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.613

Rank 1 · LXL04_026658 · OH-1004

Cytoplasm0.407

Rank 2 · LXL04_026658 · OH-1004

Cell membrane0.074

Rank 3 · LXL04_026658 · OH-1004

Endoplasmic reticulum0.054

Rank 4 · LXL04_026658 · OH-1004

Mitochondrion0.041

Rank 5 · LXL04_026658 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651.38BTB158-253 aa

PF21536.5BTB_KLHL33184-248 aa

PF07707.22BACK279-372 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026658	`PF00651.38`	BTB	158	253	3.4e-13	50.5
LXL04_026658	`PF21536.5`	BTB_KLHL33	184	248	3.8e-14	53.0
LXL04_026658	`PF07707.22`	BACK	279	372	9.8e-12	45.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FPW6`	Arabidopsis thaliana	BTB/POZ domain-containing protein POB1	75.657%	Swiss-Prot	strong database homology
`O82343`	Arabidopsis thaliana	BTB/POZ domain-containing protein At2g46260	74.825%	Swiss-Prot	strong database homology
`O04615`	Arabidopsis thaliana	BTB/POZ domain-containing protein At4g01160	54.529%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card