LXL04_026092 | RubberDandelionOmics

Gene overview

LXL04_026092

Reference: OH-1004 Chr: Chr05 Coordinates: 120764194-120765861 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1668 bp · LXL04_026092|LXL04_026092|OH1004|cDNA

ATGGCCGCCGCCGATGCCACATCCACCGCCGACGAGTTCGAAGAAGAAAGCATCAGCAAATGGGAATCCATCCGCCTCAAAACCCTAGCGGAGAAATGTTACACCTCTTCCGACCTCAAATTAGCTCTCAAACACGCCAAGCGCGCTCACCGCCTATGCCCCACCCTCGACGGCGTTTCAGAAATGCTAACCGCCTTTAAAATACTCAGCGCCGCCGCAAACACCACAGAAGCTACCGGAACACCTCATTGGTACAAGAT...

CDS

Download CDS FASTA

1668 bp · LXL04_026092|LXL04_026092|OH1004|CDS

ATGGCCGCCGCCGATGCCACATCCACCGCCGACGAGTTCGAAGAAGAAAGCATCAGCAAATGGGAATCCATCCGCCTCAAAACCCTAGCGGAGAAATGTTACACCTCTTCCGACCTCAAATTAGCTCTCAAACACGCCAAGCGCGCTCACCGCCTATGCCCCACCCTCGACGGCGTTTCAGAAATGCTAACCGCCTTTAAAATACTCAGCGCCGCCGCAAACACCACAGAAGCTACCGGAACACCTCATTGGTACAAGAT...

Protein

Download Protein FASTA

555 aa · LXL04_026092|LXL04_026092|OH1004|PROTEIN

MAAADATSTADEFEEESISKWESIRLKTLAEKCYTSSDLKLALKHAKRAHRLCPTLDGVSEMLTAFKILSAAANTTEATGTPHWYKILEVEPFSHINLIKKQYKKLALILHPDKNTFVASEEAFKLVNEAFTVLSDKIKRKEYDMKLRIAIQTEAEAEAGEQPGGDSSTLDTFWTACSTCRLLHQFERKYLEHNLMCPSCKKSFKAMEVEDGKKGDPKVVDEIKTIDSDTSESDRVLTRSNSKRKMSSVGEIMKRSEQSK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026092`
TK1151 ID	TkA06G027960
OH-1004 ID	LXL04_026092
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	75.400
Protein coverage (%)	TK1151 100.000 / OH-1004 40.360 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026092

Location Chr05:120764194-120765861 (-)

Description Similar to dnaJ: Chaperone protein DnaJ (Helicobacter pylori (strain ATCC 700392 / 26695)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49060`	Plays a continuous role in plant development probably in the structural organization of compartments.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026092 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0006457 protein folding Biological Process

GO:0009408 response to heat Biological Process

GO:0042026 protein refolding Biological Process

GO:0071218 cellular response to misfolded protein Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0030544 Hsp70 protein binding Molecular Function

GO:0031072 heat shock protein binding Molecular Function

KEGG gene cross-reference

ath:AT5G49060

heo:C694_06875

hpj:jhp_1252

hpy:HP_1332

mma:MM_2504

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · LXL04_026092 · OH-1004

Cytoplasm0.071

Rank 2 · LXL04_026092 · OH-1004

Cell membrane0.029

Rank 3 · LXL04_026092 · OH-1004

Endoplasmic reticulum0.017

Rank 4 · LXL04_026092 · OH-1004

Plastid0.013

Rank 5 · LXL04_026092 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226.37DnaJ84-144 aa

PF23551.1Zn_ribbon_20173-206 aa

PF11926.14DUF3444331-528 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026092	`PF00226.37`	DnaJ	84	144	3e-19	69.6
LXL04_026092	`PF23551.1`	Zn_ribbon_20	173	206	2.5e-07	31.3
LXL04_026092	`PF11926.14`	DUF3444	331	528	8.3e-65	219.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FH28`	Arabidopsis thaliana	Chaperone protein dnaJ 49	31.646%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card