RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_026068
Reference: OH-1004 Chr: Chr05 Coordinates: 120538967-120541321 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1548 bp · LXL04_026068|LXL04_026068|OH1004|cDNA

ATGAGCTGGAGGCCAAGATTCCCTGGGTGTGTATCTAGCTGTAATGGTGTACCTCTTTTCCCTTCCGAAGCTTACTTATATATACCTCACTTCCTCCCTCCCACTTTCTATCAAACCACCATCAACCTAATTAACAAAACTATGGAACTCATTACCGTCTTCTCTTGTTTCTTTATCCTTTTGTCTACTGTTTTTCTCTTTAAATCCGTCGTCGCCTCCGCCGCCCGCCGGAAAAGCCTCCCACTTCCTCCCGGAACACT...

CDS

Download CDS FASTA

1548 bp · LXL04_026068|LXL04_026068|OH1004|CDS

ATGAGCTGGAGGCCAAGATTCCCTGGGTGTGTATCTAGCTGTAATGGTGTACCTCTTTTCCCTTCCGAAGCTTACTTATATATACCTCACTTCCTCCCTCCCACTTTCTATCAAACCACCATCAACCTAATTAACAAAACTATGGAACTCATTACCGTCTTCTCTTGTTTCTTTATCCTTTTGTCTACTGTTTTTCTCTTTAAATCCGTCGTCGCCTCCGCCGCCCGCCGGAAAAGCCTCCCACTTCCTCCCGGAACACT...

Protein

Download Protein FASTA

515 aa · LXL04_026068|LXL04_026068|OH1004|PROTEIN

MSWRPRFPGCVSSCNGVPLFPSEAYLYIPHFLPPTFYQTTINLINKTMELITVFSCFFILLSTVFLFKSVVASAARRKSLPLPPGTLGWPYIGETFQLYSQNPNVFFASKVKKYGSIFKTHVLGCRCVMISSPAAAKLVLVTKSHLFKPTFPASKERMLGKQAIFFHQGDYHSKLRRLVLRAFTPESIKNIIPDIESIAVDSLQGWENRLINTFQEMKTFTFNVALLSIFGKDEVLYREDLKRCYYILEKGYNSMPINLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_026068
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_026068
LocationChr05:120538967-120541321 (+)
DescriptionSimilar to CYP707A2: Abscisic acid 8'-hydroxylase CYP707A2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g19230 Involved in the oxidative degradation of abscisic acid.
The Arabidopsis cytochrome P450 CYP707A encodes ABA 8'-hydroxylases: key enzymes in ABA catabolism.2004 · DOI: 10.1038/sj.emboj.7600121
Arabidopsis CYP707As encode (+)-abscisic acid 8'-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid.2004 · DOI: 10.1104/pp.103.037614
CYP707A1 and CYP707A2, which encode abscisic acid 8'-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis.2006 · DOI: 10.1104/pp.106.079475
At5g45340 Participates in ABA oxidative degradation but does not catalyze the isomerization of 8′-hydroxy-ABA to (−)-phaseic acid.
Arabidopsis CYP707As encode (+)-abscisic acid 8'-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid.2004 · DOI: 10.1104/pp.103.037614
CYP707A3, a major ABA 8'-hydroxylase involved in dehydration and rehydration response in Arabidopsis thaliana.2006 · DOI: 10.1111/j.1365-313x.2006.02683.x

Rice

Reference gene IDPossible functionPapers / DOI
Os02g0703600 Involved in the oxidative degradation of abscisic acid. No verified direct reference in this release
UniProt: Q09J79 Involved in the oxidative degradation of abscisic acid. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_026068 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0001666 response to hypoxia Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009639 response to red or far red light Biological Process
GO:0009687 abscisic acid metabolic process Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009835 fruit ripening Biological Process
GO:0016125 sterol metabolic process Biological Process
GO:0046345 abscisic acid catabolic process Biological Process
GO:0048838 release of seed from dormancy Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0071456 cellular response to hypoxia Biological Process
GO:0005576 extracellular region Cellular Component
KEGG gene cross-reference
ath:AT4G19230
ath:AT5G45340
sly:101249565
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.782
Rank 1 · LXL04_026068 · OH-1004
Golgi apparatus0.150
Rank 2 · LXL04_026068 · OH-1004
Cytoplasm0.060
Rank 3 · LXL04_026068 · OH-1004
Nucleus0.048
Rank 4 · LXL04_026068 · OH-1004
Cell membrane0.040
Rank 5 · LXL04_026068 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067.28p45083-483 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_026068PF00067.28p450834834.7e-77260.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q949P1Arabidopsis thalianaAbscisic acid 8'-hydroxylase 176.407%Swiss-Protstrong database homology
Q9FH76Arabidopsis thalianaAbscisic acid 8'-hydroxylase 376.201%Swiss-Protstrong database homology
Q05JG2Oryza sativa subsp. japonicaAbscisic acid 8'-hydroxylase 166.167%Swiss-Protstrong database homology
Q09J79Oryza sativa subsp. indicaAbscisic acid 8'-hydroxylase 166.167%Swiss-Protstrong database homology

JBrowse

View in Genome Browser