LXL04_023730 | RubberDandelionOmics

Gene overview

LXL04_023730

Reference: OH-1004 Chr: Chr05 Coordinates: 65821233-65823780 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1143 bp · LXL04_023730|LXL04_023730|OH1004|cDNA

ATGACGAACCATTGTGAATCTAAGATTCTTCTTGCCACTTTACTAGGGACTCGGAAGGTGGAATCGGAGATTTCAAGAACTGGAAGACTGTCGATGAAGGGTTTTGGGGGAGTGAAAGTGGTGTTGCAGGTCATCTCAAACCATTCGCTCAGAGAGCAGCCGGGACCGATACCGAAGGGATATGGAATTGAAGCCACACCGTCGCTATCAGACCCACCTAAAATCGCAACACCATCGCAACTACAACTCACCTCCAAATA...

CDS

Download CDS FASTA

1143 bp · LXL04_023730|LXL04_023730|OH1004|CDS

ATGACGAACCATTGTGAATCTAAGATTCTTCTTGCCACTTTACTAGGGACTCGGAAGGTGGAATCGGAGATTTCAAGAACTGGAAGACTGTCGATGAAGGGTTTTGGGGGAGTGAAAGTGGTGTTGCAGGTCATCTCAAACCATTCGCTCAGAGAGCAGCCGGGACCGATACCGAAGGGATATGGAATTGAAGCCACACCGTCGCTATCAGACCCACCTAAAATCGCAACACCATCGCAACTACAACTCACCTCCAAATA...

Protein

Download Protein FASTA

380 aa · LXL04_023730|LXL04_023730|OH1004|PROTEIN

MTNHCESKILLATLLGTRKVESEISRTGRLSMKGFGGVKVVLQVISNHSLREQPGPIPKGYGIEATPSLSDPPKIATPSQLQLTSKYHICHHQRLGLSLLSYGFGAYFNILPGSEWSAIMLTYGFPLTIIGMALLGGGVARRNAPILKKIREEVTEDGKYCLVLVFEAKALELADFEKRQEKFTSFFGPGITAEEKVKNRICTMYALFQTQHCNYSHTTPYTCSFNYSGEAIDEEDMYFLDADKENDDDDDDVDENDDAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023730`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023730

Location Chr05:65821233-65823780 (+)

Description Similar to At2g40430: Ribosome biogenesis protein NOP53

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40430`	May play a role in ribosome biogenesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023730 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000027 ribosomal large subunit assembly Biological Process

GO:0000460 maturation of 5.8S rRNA Biological Process

GO:0006364 rRNA processing Biological Process

GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0051781 positive regulation of cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0008097 5S rRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G40430

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.586

Rank 1 · LXL04_023730 · OH-1004

Cytoplasm0.257

Rank 2 · LXL04_023730 · OH-1004

Mitochondrion0.108

Rank 3 · LXL04_023730 · OH-1004

Cell membrane0.045

Rank 4 · LXL04_023730 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_023730 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11016.14DUF2854141-194 aa

PF07767.17Nop53239-351 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023730	`PF11016.14`	DUF2854	141	194	1.1e-18	68.3
LXL04_023730	`PF07767.17`	Nop53	239	351	6.5e-11	42.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22892`	Arabidopsis thaliana	Ribosome biogenesis protein NOP53	47.337%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card