LXL04_023377 | RubberDandelionOmics

Gene overview

LXL04_023377

Reference: OH-1004 Chr: Chr05 Coordinates: 36458170-36461388 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

978 bp · LXL04_023377|LXL04_023377|OH1004|cDNA

ATGACTGGTGCCGTGGGCGTTATCCAAACCCTCAATCCCTCCACATTTCCACTACCAAACGCCACAACTCCACCACTAATTTCTAGAAATAAATCAATCAAGCCGCTCTACTCAATAACAGCAGAGATTAATGAGATCAGGGTGTGCACTAACCGACCTTGCCGGCGACAAGGGTCAATGGAGACCCTTCAAGTCCTCTCAGGCATCAATCCACCGAATATCGCCGTCAATTCCAGCGGTTGTTTGGGCCGATGCGGCGC...

CDS

Download CDS FASTA

978 bp · LXL04_023377|LXL04_023377|OH1004|CDS

ATGACTGGTGCCGTGGGCGTTATCCAAACCCTCAATCCCTCCACATTTCCACTACCAAACGCCACAACTCCACCACTAATTTCTAGAAATAAATCAATCAAGCCGCTCTACTCAATAACAGCAGAGATTAATGAGATCAGGGTGTGCACTAACCGACCTTGCCGGCGACAAGGGTCAATGGAGACCCTTCAAGTCCTCTCAGGCATCAATCCACCGAATATCGCCGTCAATTCCAGCGGTTGTTTGGGCCGATGCGGCGC...

Protein

Download Protein FASTA

325 aa · LXL04_023377|LXL04_023377|OH1004|PROTEIN

MTGAVGVIQTLNPSTFPLPNATTPPLISRNKSIKPLYSITAEINEIRVCTNRPCRRQGSMETLQVLSGINPPNIAVNSSGCLGRCGAGPNLVLLPGATYLKHCATAARAAEIMATVTGNDLESGKTSLETLSTRKKAEIEIEKGDFAMAEILLSEAIDLNPVGGLHYIYKARSVARLGMNKAVDALGDAIEASTLAPKYPEAYTCKGDALMAMEQFEAAGDSYSMALELDPSISRSKSFKIITPPKCPSSYEKLLQNKTG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023377`
TK1151 ID	TkA06G348790
OH-1004 ID	LXL04_023377
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023377

Location Chr05:36458170-36461388 (-)

Description Similar to HOP3: Hsp70-Hsp90 organizing protein 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g12400`	Mediates the association of the molecular chaperones HSP70 and HSP90.	No verified direct reference in this release
`At1g12270`	Mediates the association of the molecular chaperones HSP70 and HSP90.	No verified direct reference in this release
`At1g62740`	Mediates the association of the molecular chaperones HSP70 and HSP90.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023377 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006620 post-translational protein targeting to endoplasmic reticulum membrane Biological Process

GO:0006986 response to unfolded protein Biological Process

GO:0009408 response to heat Biological Process

GO:0009611 response to wounding Biological Process

GO:0010286 heat acclimation Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0051131 chaperone-mediated protein complex assembly Biological Process

GO:0051260 protein homooligomerization Biological Process

GO:0051291 protein heterooligomerization Biological Process

GO:0070417 cellular response to cold Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT1G12270

ath:AT1G62740

ath:AT4G12400

gmx:547932

hsa:54557

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.969

Rank 1 · LXL04_023377 · OH-1004

Mitochondrion0.040

Rank 2 · LXL04_023377 · OH-1004

Cytoplasm0.029

Rank 3 · LXL04_023377 · OH-1004

Nucleus0.026

Rank 4 · LXL04_023377 · OH-1004

Peroxisome0.017

Rank 5 · LXL04_023377 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00515.35TPR_1200-232 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023377	`PF00515.35`	TPR_1	200	232	3e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STH1`	Arabidopsis thaliana	Hsp70-Hsp90 organizing protein 3	35.955%	Swiss-Prot	weak database homology
`Q9LNB6`	Arabidopsis thaliana	Hsp70-Hsp90 organizing protein 1	35.955%	Swiss-Prot	weak database homology
`Q5XEP2`	Arabidopsis thaliana	Hsp70-Hsp90 organizing protein 2	35.955%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card