LXL04_022855 | RubberDandelionOmics

Gene overview

LXL04_022855

Reference: OH-1004 Chr: Chr05 Coordinates: 10840824-10843143 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1107 bp · LXL04_022855|LXL04_022855|OH1004|cDNA

ATGGGAAACAAAACGGAGGAAAAACGTTCGAGTTCACGATCCAACCATTTGTTGCAGAAGATAAGAGATTTTACTCTTTCCATTGTCGAAGATGTTTCTCATGGCTATTCTCCAGCAATTTACATTTATCGTTTCCGTAATTACTGCACCGATATATCTGGAAACTGCTATTGCAGCCACGATTCAGTCAAGGGACTGGAGATTCTCACCCTACAGCGAGATTGTCATGCACGTAGATTAGATGTTTTATTGCGAGTGCT...

CDS

Download CDS FASTA

1107 bp · LXL04_022855|LXL04_022855|OH1004|CDS

ATGGGAAACAAAACGGAGGAAAAACGTTCGAGTTCACGATCCAACCATTTGTTGCAGAAGATAAGAGATTTTACTCTTTCCATTGTCGAAGATGTTTCTCATGGCTATTCTCCAGCAATTTACATTTATCGTTTCCGTAATTACTGCACCGATATATCTGGAAACTGCTATTGCAGCCACGATTCAGTCAAGGGACTGGAGATTCTCACCCTACAGCGAGATTGTCATGCACGTAGATTAGATGTTTTATTGCGAGTGCT...

Protein

Download Protein FASTA

368 aa · LXL04_022855|LXL04_022855|OH1004|PROTEIN

MGNKTEEKRSSSRSNHLLQKIRDFTLSIVEDVSHGYSPAIYIYRFRNYCTDISGNCYCSHDSVKGLEILTLQRDCHARRLDVLLRVLLIVQQLLQENRHGSKRDIYYMHPSVFREQSVVDRAINDICILFKCSRHNLNVVSVAKGLVMGWLRFSEGDRLFNCINQPDNAHSIPVHVEDVKDVVSIAEYILVVEKESVFQRLANDCFCKTNRCIVITGRGYPDIPTRRFLRLLIEELQLPAYCLVDCDPYGFDILTTYRFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022855`
TK1151 ID	TkA02G075560
OH-1004 ID	LXL04_022855
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	97.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022855

Location Chr05:10840824-10843143 (-)

Description Similar to SPO11-1: Meiotic recombination protein SPO11-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g13170`	DNA endonuclease, which specifically mediates DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination.	AtSPO11-1 is necessary for efficient meiotic recombination in plants.2001 · DOI: 10.1093/emboj/20.3.589 Arabidopsis SPO11-2 functions with SPO11-1 in meiotic recombination.2006 · DOI: 10.1111/j.1365-313x.2006.02867.x The catalytically active tyrosine residues of both SPO11-1 and SPO11-2 are required for meiotic double-strand break induction in Arabidopsis.2007 · DOI: 10.1105/tpc.107.054817 A high throughput genetic screen identifies new early meiotic recombination functions in Arabidopsis thaliana.2009 · DOI: 10.1371/journal.pgen.1000654 A DNA topoisomerase VI-like complex initiates meiotic recombination.2016 · DOI: 10.1126/science.aad5196

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0752200`	DNA endonuclease, which specifically mediates DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination.	OsSPO11-1 is essential for both homologous chromosome pairing and crossover formation in rice.2010 · DOI: 10.1007/s00412-010-0284-7
`UniProt: Q5ZPV8`	DNA endonuclease, which specifically mediates DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022855 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000706 meiotic DNA double-strand break processing Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0007130 synaptonemal complex assembly Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0007141 male meiosis I Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0007286 spermatid development Biological Process

GO:0007292 female gamete generation Biological Process

GO:0034502 protein localization to chromosome Biological Process

GO:0042138 meiotic DNA double-strand break formation Biological Process

GO:0045141 meiotic telomere clustering Biological Process

KEGG gene cross-reference

ath:AT3G13170

dosa:Os03g0752200

hsa:23626

mmu:26972

osa:9267055

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.473

Rank 1 · LXL04_022855 · OH-1004

Nucleus0.395

Rank 2 · LXL04_022855 · OH-1004

Mitochondrion0.103

Rank 3 · LXL04_022855 · OH-1004

Cell membrane0.076

Rank 4 · LXL04_022855 · OH-1004

Endoplasmic reticulum0.052

Rank 5 · LXL04_022855 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04406.20TP6A_N78-139 aa

PF21180.4TOP6A-Spo11_Toprim188-359 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022855	`PF04406.20`	TP6A_N	78	139	7.9e-22	77.6
LXL04_022855	`PF21180.4`	TOP6A-Spo11_Toprim	188	359	3.8e-66	223.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M4A2`	Arabidopsis thaliana	Meiotic recombination protein SPO11-1	67.606%	Swiss-Prot	strong database homology
`Q7Y021`	Oryza sativa subsp. japonica	Meiotic recombination protein SPO11-1	62.464%	Swiss-Prot	strong database homology
`Q5ZPV8`	Oryza sativa subsp. indica	Meiotic recombination protein SPO11-1	62.464%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card