LXL04_022527 | RubberDandelionOmics

Gene overview

LXL04_022527

Reference: OH-1004 Chr: Chr05 Coordinates: 250169-257633 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4251 bp · LXL04_022527|LXL04_022527|OH1004|cDNA

ATGGAAAATGATACtaatgaagatatgaagaacactaATGATGTAGAAGATGCATCTGTGATTGATACTAAAGCAAAATTGTCTGGATCTGgtaaaaagaagaagaaattcaACATAGAGAAGATGGAATCGATTGAAATCAAAAGTTCTAAACTAAAGGGACACTTTAATCACTTAGCTAAGAAGAAACAAATCAGAAGTAGAATGGAGGAAGTAGCTACTTCTAAGAAGGAAGGAAATGAAGATGAATTGAATCCTAT...

CDS

Download CDS FASTA

4251 bp · LXL04_022527|LXL04_022527|OH1004|CDS

ATGGAAAATGATACTAATGAAGATATGAAGAACACTAATGATGTAGAAGATGCATCTGTGATTGATACTAAAGCAAAATTGTCTGGATCTGGTAAAAAGAAGAAGAAATTCAACATAGAGAAGATGGAATCGATTGAAATCAAAAGTTCTAAACTAAAGGGACACTTTAATCACTTAGCTAAGAAGAAACAAATCAGAAGTAGAATGGAGGAAGTAGCTACTTCTAAGAAGGAAGGAAATGAAGATGAATTGAATCCTAT...

Protein

Download Protein FASTA

1416 aa · LXL04_022527|LXL04_022527|OH1004|PROTEIN

MENDTNEDMKNTNDVEDASVIDTKAKLSGSGKKKKKFNIEKMESIEIKSSKLKGHFNHLAKKKQIRSRMEEVATSKKEGNEDELNPIVDSAMENDNYNKESTKWNSEGGSSLIVDTVMQAAIEKALNDNFANETVTQNIEHVKDQLNGSVDAGSNSHLGINGDPKLFPGNPTDSEMMNVTDGDTLRSIDDTIIAKMMEQGNNQNVKNVLSDIQNKESEQGMNQLKNSSSENAMEVDSVNNNIEGSTIDLSLNEKTGELKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022527`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022527

Location Chr05:250169-257633 (+)

Description Similar to VPS51: Vacuolar protein sorting-associated protein 51 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02030`	Acts as a component of the GARP complex that is involved in retrograde transport from early and late endosomes to the trans-Golgi network (TGN).	Arabidopsis UNHINGED encodes a VPS51 homolog and reveals a role for the GARP complex in leaf shape and vein patterning.2014 · DOI: 10.1242/dev.099333
`At4g02060`	Probable component of the MCM2-7 complex (MCM complex) that may function as a DNA helicase and which is essential to undergo a single round of replication initiation and elongation per cell cycle in eukaryotic cells (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0560700`	Probable component of the MCM2-7 complex (MCM complex) that may function as a DNA helicase and which is essential to undergo a single round of replication initiation and elongation per cell cycle in eukaryotic cells.	No verified direct reference in this release
`UniProt: B8BMI1`	Probable component of the MCM2-7 complex (MCM complex) that may function as a DNA helicase and which is essential to undergo a single round of replication initiation and elongation per cell cycle in eukaryotic cells.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022527 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000727 double-strand break repair via break-induced replication Biological Process

GO:0006270 DNA replication initiation Biological Process

GO:0006271 DNA strand elongation involved in DNA replication Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006869 lipid transport Biological Process

GO:0006914 autophagy Biological Process

GO:0007030 Golgi organization Biological Process

GO:0007034 vacuolar transport Biological Process

GO:0007041 lysosomal transport Biological Process

GO:0009555 pollen development Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

KEGG gene cross-reference

ath:AT4G02030

ath:AT4G02060

dme:Dmel_CG15087

dosa:Os12g0560700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.417

Rank 1 · LXL04_022527 · OH-1004

Nucleus0.328

Rank 2 · LXL04_022527 · OH-1004

Cell membrane0.213

Rank 3 · LXL04_022527 · OH-1004

Endoplasmic reticulum0.091

Rank 4 · LXL04_022527 · OH-1004

Golgi apparatus0.075

Rank 5 · LXL04_022527 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14111.13DUF4283333-408 aa

PF14551.12MCM_N1035-1114 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022527	`PF14111.13`	DUF4283	333	408	2.7e-11	43.7
LXL04_022527	`PF14551.12`	MCM_N	1035	1114	1.7e-09	38.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WQ75`	Arabidopsis thaliana	Vacuolar protein sorting-associated protein 51 homolog	56.727%	Swiss-Prot	weak database homology
`P43299`	Arabidopsis thaliana	DNA replication licensing factor MCM7	67.619%	Swiss-Prot	weak database homology
`Q2QNM1`	Oryza sativa subsp. japonica	DNA replication licensing factor MCM7	67.593%	Swiss-Prot	weak database homology
`B8BMI1`	Oryza sativa subsp. indica	DNA replication licensing factor MCM7	67.593%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card