LXL04_021931 | RubberDandelionOmics

Gene overview

LXL04_021931

Reference: OH-1004 Chr: Chr04 Coordinates: 140603588-140610102 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3537 bp · LXL04_021931|LXL04_021931|OH1004|cDNA

ATGTTCACACAGTTCGGCACCACCGCCGAGAACTTTAGCAAGGCGTCAACAATGGTGTTTCGGATCGGAACAGACGCTCACCTCTATGACGATCCTGACGATGTCAGTATTACACCTCTTCTGGACAGCAAATTCGACTCTGAAAAATGCGAAGCTCTTAAACGATTGCTCGCTCTGATTGCCCAAGGCTTAGATGTATCCAATTATTTCCCTCAGGTCGTTAAGAATGTTGCATCTCAGTCATTGGAGGTTAAGAAGCT...

CDS

Download CDS FASTA

3537 bp · LXL04_021931|LXL04_021931|OH1004|CDS

ATGTTCACACAGTTCGGCACCACCGCCGAGAACTTTAGCAAGGCGTCAACAATGGTGTTTCGGATCGGAACAGACGCTCACCTCTATGACGATCCTGACGATGTCAGTATTACACCTCTTCTGGACAGCAAATTCGACTCTGAAAAATGCGAAGCTCTTAAACGATTGCTCGCTCTGATTGCCCAAGGCTTAGATGTATCCAATTATTTCCCTCAGGTCGTTAAGAATGTTGCATCTCAGTCATTGGAGGTTAAGAAGCT...

Protein

Download Protein FASTA

1178 aa · LXL04_021931|LXL04_021931|OH1004|PROTEIN

MFTQFGTTAENFSKASTMVFRIGTDAHLYDDPDDVSITPLLDSKFDSEKCEALKRLLALIAQGLDVSNYFPQVVKNVASQSLEVKKLVYLYLLHYAERQVDNILTLNQTLRPNEALLSINIFQRDLGDQNPLVRAWALRTMAGIRLHVISPLVLVAVRKCARDPSVYVRKCAANALPKLNDLRLEENEASIIEIIGILLNDNSPGVVGAAAAAFASICPNNLPLIGRNYTRLCEMLPDVEEWGQIILIGILLRYVISKRG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021931`
TK1151 ID	TkA05G432100
OH-1004 ID	LXL04_021931
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021931

Location Chr04:140603588-140610102 (+)

Description Similar to AP3BA: AP3-complex subunit beta-A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55480`	Part of the AP-3 complex, an adaptor-related complex which seems to be clathrin-associated.	The AP-3 β adaptin mediates the biogenesis and function of lytic vacuoles in Arabidopsis.2010 · DOI: 10.1105/tpc.110.075424 The AP-3 adaptor complex is required for vacuolar function in Arabidopsis.2011 · DOI: 10.1038/cr.2011.99

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021931 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006882 intracellular zinc ion homeostasis Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006896 Golgi to vacuole transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0035654 clathrin-coated vesicle cargo loading, AP-3-mediated Biological Process

GO:0048499 synaptic vesicle membrane organization Biological Process

GO:0051453 regulation of intracellular pH Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0080171 lytic vacuole organization Biological Process

GO:0099180 zinc ion import into synaptic vesicle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005769 early endosome Cellular Component

KEGG gene cross-reference

ath:AT3G55480

bta:767602

cfa:403459

hsa:8120

mmu:11775

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.515

Rank 1 · LXL04_021931 · OH-1004

Nucleus0.240

Rank 2 · LXL04_021931 · OH-1004

Golgi apparatus0.219

Rank 3 · LXL04_021931 · OH-1004

Lysosome / Vacuole0.142

Rank 4 · LXL04_021931 · OH-1004

Cell membrane0.132

Rank 5 · LXL04_021931 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01602.27Adaptin_N41-651 aa

PF13646.13HEAT_2127-213 aa

PF12717.14Cnd1132-275 aa

PF14796.12AP3B1_C811-921 aa

PF24080.2AP3B1_C_2949-1085 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021931	`PF01602.27`	Adaptin_N	41	651	1.7e-95	321.3
LXL04_021931	`PF13646.13`	HEAT_2	127	213	2.8e-06	28.2
LXL04_021931	`PF12717.14`	Cnd1	132	275	4.5e-18	66.5
LXL04_021931	`PF14796.12`	AP3B1_C	811	921	1.1e-08	35.9
LXL04_021931	`PF24080.2`	AP3B1_C_2	949	1085	3.1e-07	31.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2T1`	Arabidopsis thaliana	AP3-complex subunit beta-A	51.449%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card