LXL04_016974 | RubberDandelionOmics

Gene overview

LXL04_016974

Reference: OH-1004 Chr: Chr03 Coordinates: 138238013-138241323 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

891 bp · LXL04_016974|LXL04_016974|OH1004|cDNA

ATGGAGAATAGAATACCACCAGGAAGTTACTTCCAGTACTCTCCTACTGGAGTTCATAGTTCACTCCAGAGGTCTTCGTCTCCCTCAGATCGTGAAAGATATTTGGCAGAATTACTTGCAGAGAGGCAAAAGTTGGCACCATTTATGCAAGTCATGCCAATATGCAGCAGGCTCCTAAATCAAGAGATCATGAAAACATCGGGAATGGTGTCGAATCATAATTTTGTGGATCATGAAAGGATGTTGCGTGACAGGTCATC...

CDS

Download CDS FASTA

891 bp · LXL04_016974|LXL04_016974|OH1004|CDS

ATGGAGAATAGAATACCACCAGGAAGTTACTTCCAGTACTCTCCTACTGGAGTTCATAGTTCACTCCAGAGGTCTTCGTCTCCCTCAGATCGTGAAAGATATTTGGCAGAATTACTTGCAGAGAGGCAAAAGTTGGCACCATTTATGCAAGTCATGCCAATATGCAGCAGGCTCCTAAATCAAGAGATCATGAAAACATCGGGAATGGTGTCGAATCATAATTTTGTGGATCATGAAAGGATGTTGCGTGACAGGTCATC...

Protein

Download Protein FASTA

296 aa · LXL04_016974|LXL04_016974|OH1004|PROTEIN

MENRIPPGSYFQYSPTGVHSSLQRSSSPSDRERYLAELLAERQKLAPFMQVMPICSRLLNQEIMKTSGMVSNHNFVDHERMLRDRSSFRSFNQKPNRGPMDVEAWPPMQPEDNRLLQRMASFQASAMGWPASPGMATTPTVIKKVIRLDVPVEKFPNYNFVGRILGPRGNSLKRIEAMTECRIYIRGRGSVKDSVKEEKLKDKPGYEHLNDPLHLLLEAEFPEDMIDSRLDHAVALLENLLKPVDESMDTYKKHQLRELA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016974`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016974

Location Chr03:138238013-138241323 (+)

Description Similar to At1g09660/At1g09670: KH domain-containing protein At1g09660/At1g09670

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q8GWR3`	KH domain-containing protein At1g09660/At1g09670.	No verified direct reference in this release
`At3g08620`	KH domain-containing protein At3g08620.	No verified direct reference in this release
`At2g38610`	KH domain-containing protein At2g38610.	No verified direct reference in this release
`At4g26480`	KH domain-containing protein At4g26480.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0815700`	Involved in flowering time control.	SPIN1, a K homology domain protein negatively regulated and ubiquitinated by the E3 ubiquitin ligase SPL11, is involved in flowering time control in rice.2008 · DOI: 10.1105/tpc.108.058610

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016974 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009908 flower development Biological Process

GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process

GO:0048577 negative regulation of short-day photoperiodism, flowering Biological Process

GO:0048579 negative regulation of long-day photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G09660

ath:AT2G38610

ath:AT3G08620

ath:AT4G26480

dosa:Os03g0815700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.861

Rank 1 · LXL04_016974 · OH-1004

Cytoplasm0.279

Rank 2 · LXL04_016974 · OH-1004

Cell membrane0.022

Rank 3 · LXL04_016974 · OH-1004

Mitochondrion0.022

Rank 4 · LXL04_016974 · OH-1004

Endoplasmic reticulum0.012

Rank 5 · LXL04_016974 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16544.11STAR_dimer30-79 aa

PF22675.3KH-I_KHDC4-BBP155-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016974	`PF16544.11`	STAR_dimer	30	79	2.9e-13	49.8
LXL04_016974	`PF22675.3`	KH-I_KHDC4-BBP	155	242	9.4e-21	74.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GWR3`	Arabidopsis thaliana	KH domain-containing protein At1g09660/At1g09670	63.423%	Swiss-Prot	strong database homology
`Q8GYR4`	Arabidopsis thaliana	KH domain-containing protein At3g08620	50.865%	Swiss-Prot	strong database homology
`Q9ZVI3`	Arabidopsis thaliana	KH domain-containing protein At2g38610	51.557%	Swiss-Prot	strong database homology
`Q0WLR1`	Arabidopsis thaliana	KH domain-containing protein At4g26480	49.627%	Swiss-Prot	moderate database homology
`Q75GR5`	Oryza sativa subsp. japonica	KH domain-containing protein SPIN1	56.159%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card