LXL04_014938 | RubberDandelionOmics

Gene overview

LXL04_014938

Reference: OH-1004 Chr: Chr03 Coordinates: 59988684-59992970 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2142 bp · LXL04_014938|LXL04_014938|OH1004|cDNA

ATGATCTTACCAGCTTTACTGACTTCTGCTGGTTTCAATATCGTGATTTGTGTGGGATTCTTCTCGCTATATTCGATATTGAGAAAACAACCGGTTAATTTAAAAGTATACTTCGGGCAAAGGCTTGCACAGCTAAAGCCCGaacaaaaaaattattattttggTCAAAGACTTGTCCCATCTGCAGGGTGGTTAGTCAAGGCATGGGAAGCATCAGATGATGACATCTACCGTTGTGGTGGTATCGATGGACTTGTTTT...

CDS

Download CDS FASTA

2142 bp · LXL04_014938|LXL04_014938|OH1004|CDS

ATGATCTTACCAGCTTTACTGACTTCTGCTGGTTTCAATATCGTGATTTGTGTGGGATTCTTCTCGCTATATTCGATATTGAGAAAACAACCGGTTAATTTAAAAGTATACTTCGGGCAAAGGCTTGCACAGCTAAAGCCCGAACAAAAAAATTATTATTTTGGTCAAAGACTTGTCCCATCTGCAGGGTGGTTAGTCAAGGCATGGGAAGCATCAGATGATGACATCTACCGTTGTGGTGGTATCGATGGACTTGTTTT...

Protein

Download Protein FASTA

713 aa · LXL04_014938|LXL04_014938|OH1004|PROTEIN

MILPALLTSAGFNIVICVGFFSLYSILRKQPVNLKVYFGQRLAQLKPEQKNYYFGQRLVPSAGWLVKAWEASDDDIYRCGGIDGLVFIKMIVFSIRIFSVASVLCIFIVLPVNLFGQAIQERDAEAQMDMFTIRNVQAGSKGLWAHFFALYVVSISAYILLYVEFKSVARLRLEQVIRFPTKPSHFTVLVRGIPWCPGEAYSETVSKHFGSYYESSYLAHQMVYRSGTIQRLMMDAEKMYNVLKETTIPEGESEGPSAGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014938`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014938

Location Chr03:59988684-59992970 (-)

Description Similar to RXW8: CSC1-like protein RXW8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g58520`	Acts as an osmosensitive calcium-permeable cation channel.	No verified direct reference in this release
`At1g10090`	Acts as an osmosensitive calcium-permeable cation channel.	No verified direct reference in this release
`At3g01100`	Acts as an osmosensitive calcium-permeable cation channel.	No verified direct reference in this release
`At1g69450`	Acts as an osmosensitive calcium-permeable cation channel.	No verified direct reference in this release
`At3g54510`	Acts as an osmosensitive calcium-permeable cation channel.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014938 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007231 osmosensory signaling pathway Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005227 calcium-activated cation channel activity Molecular Function

GO:0008381 mechanosensitive monoatomic ion channel activity Molecular Function

KEGG gene cross-reference

ath:AT1G10090

ath:AT1G58520

ath:AT1G69450

ath:AT3G01100

ath:AT3G54510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.570

Rank 1 · LXL04_014938 · OH-1004

Lysosome / Vacuole0.165

Rank 2 · LXL04_014938 · OH-1004

Cytoplasm0.145

Rank 3 · LXL04_014938 · OH-1004

Endoplasmic reticulum0.129

Rank 4 · LXL04_014938 · OH-1004

Golgi apparatus0.080

Rank 5 · LXL04_014938 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13967.12RSN1_TM5-163 aa

PF14703.13PHM7_cyt185-339 aa

PF02714.21RSN1_7TM350-612 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014938	`PF13967.12`	RSN1_TM	5	163	4e-33	115.0
LXL04_014938	`PF14703.13`	PHM7_cyt	185	339	1.4e-21	78.2
LXL04_014938	`PF02714.21`	RSN1_7TM	350	612	6.1e-63	213.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IBD7`	Arabidopsis thaliana	Hyperosmolality-gated Ca2+ permeable channel 2.1	48.052%	Swiss-Prot	moderate database homology
`Q94A87`	Arabidopsis thaliana	Hyperosmolality-gated Ca2+ permeable channel 2.2	46.020%	Swiss-Prot	moderate database homology
`Q8GUH7`	Arabidopsis thaliana	Hyperosmolality-gated Ca2+ permeable channel 2.3	40.607%	Swiss-Prot	moderate database homology
`F4I248`	Arabidopsis thaliana	Hyperosmolality-gated Ca2+ permeable channel 2.4	35.610%	Swiss-Prot	moderate database homology
`F4JCY2`	Arabidopsis thaliana	Hyperosmolality-gated Ca2+ permeable channel 2.5	32.897%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card