LXL04_014288 | RubberDandelionOmics

Gene overview

LXL04_014288

Reference: OH-1004 Chr: Chr03 Coordinates: 45527048-45530041 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1851 bp · LXL04_014288|LXL04_014288|OH1004|cDNA

ATGGACGACGAAATTGATGTTTTTCATAAGCAGAGAGATATAGTTCCATTAAACCTAGATGACGATACCGCTGAATCTGACGATGATAATGAGCAACCAGTCTTTGAAATCGAGGGAagcgatgatgatgatgaagaagatgaagacgaagaAGATGACACCGAGCTTACTGGCTTAGCTGCAAAAATTGCAAAACAACATAAAAGTTTAAAGGCAAAGATTGGTGGCGCCAAGGATGCAACacaagatgatgatgaaga...

CDS

Download CDS FASTA

1851 bp · LXL04_014288|LXL04_014288|OH1004|CDS

ATGGACGACGAAATTGATGTTTTTCATAAGCAGAGAGATATAGTTCCATTAAACCTAGATGACGATACCGCTGAATCTGACGATGATAATGAGCAACCAGTCTTTGAAATCGAGGGAAGCGATGATGATGATGAAGAAGATGAAGACGAAGAAGATGACACCGAGCTTACTGGCTTAGCTGCAAAAATTGCAAAACAACATAAAAGTTTAAAGGCAAAGATTGGTGGCGCCAAGGATGCAACACAAGATGATGATGAAGA...

Protein

Download Protein FASTA

616 aa · LXL04_014288|LXL04_014288|OH1004|PROTEIN

MDDEIDVFHKQRDIVPLNLDDDTAESDDDNEQPVFEIEGSDDDDEEDEDEEDDTELTGLAAKIAKQHKSLKAKIGGAKDATQDDDEEDEEKKSIAWGKGKNIYYDNDKGESSEDEEEAEVLRLQNEKTKLYSNADHGLEDEEEEEEEEEEEEKEPTFEEKLKKGKASSKSKLTHEDDTDTGIEVVMKDPSSLSKEEQMDIVFSSAPELVGLLSELNEAVDQLETKVDPILIKLKAEKNLNKSGIQFMELKKQLLLSYCQA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014288`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014288

Location Chr03:45527048-45530041 (+)

Description Similar to ngdn: Neuroguidin

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43650`	Essential protein during embryogenesis.	Dual Role of a SAS10/C1D Family Protein in Ribosomal RNA Gene Expression and Processing Is Essential for Reproduction in Arabidopsis thaliana.2016 · DOI: 10.1371/journal.pgen.1006408

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014288 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0042274 ribosomal small subunit biogenesis Biological Process

GO:0000775 chromosome, centromeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0030175 filopodium Cellular Component

GO:0032040 small-subunit processome Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G43650

bta:539602

dre:386642

rno:305258

spo:2541000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.959

Rank 1 · LXL04_014288 · OH-1004

Cytoplasm0.128

Rank 2 · LXL04_014288 · OH-1004

Mitochondrion0.016

Rank 3 · LXL04_014288 · OH-1004

Cell membrane0.010

Rank 4 · LXL04_014288 · OH-1004

Extracellular0.006

Rank 5 · LXL04_014288 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04000.21Sas10_Utp3212-292 aa

PF09368.16Sas10543-614 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014288	`PF04000.21`	Sas10_Utp3	212	292	2.9e-17	63.7
LXL04_014288	`PF09368.16`	Sas10	543	614	1.5e-21	77.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L3P4`	Arabidopsis thaliana	Protein THALLO	46.457%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card