LXL04_012353 | RubberDandelionOmics

Gene overview

LXL04_012353

Reference: OH-1004 Chr: Chr03 Coordinates: 10931035-10932946 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

939 bp · LXL04_012353|LXL04_012353|OH1004|cDNA

ATGAAGGTGACCGTTACTACTCGGAGCGGAAGAGAATTAATCAATGGCGGTCTCGTCCTTGATAGCTCTGATACCGTTGCTGATTTGCAGGAGGCAATTCATCGGCGAACCAAAAAATACTACCCATCCAGACAACGCCTAACCCTCCCCCTCCAACCCGGATCCAAAGAAAAACCCACCGTCCTCAATTACAAAAAAACCCTCCAAGACTACACCACCGGAAACTCCGACGCCATAACCGTCGTCTTCAAAGACCTGGG...

CDS

Download CDS FASTA

939 bp · LXL04_012353|LXL04_012353|OH1004|CDS

ATGAAGGTGACCGTTACTACTCGGAGCGGAAGAGAATTAATCAATGGCGGTCTCGTCCTTGATAGCTCTGATACCGTTGCTGATTTGCAGGAGGCAATTCATCGGCGAACCAAAAAATACTACCCATCCAGACAACGCCTAACCCTCCCCCTCCAACCCGGATCCAAAGAAAAACCCACCGTCCTCAATTACAAAAAAACCCTCCAAGACTACACCACCGGAAACTCCGACGCCATAACCGTCGTCTTCAAAGACCTGGG...

Protein

Download Protein FASTA

312 aa · LXL04_012353|LXL04_012353|OH1004|PROTEIN

MKVTVTTRSGRELINGGLVLDSSDTVADLQEAIHRRTKKYYPSRQRLTLPLQPGSKEKPTVLNYKKTLQDYTTGNSDAITVVFKDLGPQVSYRTLFFFEYLGPLILYPIFYYFPVIYQFFGYKSQPRVIHPVQTLAMYYWCFHYFKRIMETFFVHRFSHATSPLSNVFRNCAYYWSFGCYIAYYVNHPFYTPVSDVQVKIGLGFGVIMQISNLYCHVILRNLRSPSGNGGYQIPRGFLFNIVTCANYTTEIYQWLGFNVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012353`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012353

Location Chr03:10931035-10932946 (+)

Description Similar to ECR: Very-long-chain enoyl-CoA reductase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55360`	Catalyzes the last of the four reactions of the long-chain fatty acids elongation cycle.	Functional characterization of the Arabidopsis thaliana orthologue of Tsc13p, the enoyl reductase of the yeast microsomal fatty acid elongating system.2004 · DOI: 10.1093/jxb/erh061 Disruptions of the Arabidopsis Enoyl-CoA reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant morphogenesis.2005 · DOI: 10.1105/tpc.104.030155 ECERIFERUM 10 Encoding an Enoyl-CoA Reductase Plays a Crucial Role in Osmotolerance and Cuticular Wax Loading in Arabidopsis.2022 · DOI: 10.3389/fpls.2022.898317

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012353 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006665 sphingolipid metabolic process Biological Process

GO:0006694 steroid biosynthetic process Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0010091 trichome branching Biological Process

GO:0030497 fatty acid elongation Biological Process

GO:0035338 long-chain fatty-acyl-CoA biosynthetic process Biological Process

GO:0042761 very long-chain fatty acid biosynthetic process Biological Process

GO:0160062 cutin-based cuticle development Biological Process

GO:1905499 trichome papilla formation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT3G55360

bta:614105

cel:CELE_C15F1.6

ddi:DDB_G0270270

hsa:9524

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.836

Rank 1 · LXL04_012353 · OH-1004

Nucleus0.086

Rank 2 · LXL04_012353 · OH-1004

Cytoplasm0.085

Rank 3 · LXL04_012353 · OH-1004

Golgi apparatus0.074

Rank 4 · LXL04_012353 · OH-1004

Cell membrane0.060

Rank 5 · LXL04_012353 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02544.22Steroid_dh161-311 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012353	`PF02544.22`	Steroid_dh	161	311	1.2e-27	97.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2U2`	Arabidopsis thaliana	Very-long-chain enoyl-CoA reductase	77.244%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card