LXL04_012294 | RubberDandelionOmics

Gene overview

LXL04_012294

Reference: OH-1004 Chr: Chr03 Coordinates: 9881443-9882697 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

956 bp · LXL04_012294|LXL04_012294|OH1004|cDNA

GCTCGATTTCTATAAGGGATTTTTAAGAACGCCGGCAGTGCCTGAAGATGTCAGCATATGGCCATCAGATGGAACGGGAGCATTCTTCCCGGAGTCTCACAAGCGGTGAAGGATCTGAGATCGGAAGTCAATTTCGAATGGAATCGGTGATCTACATGTCATCATGTGCTGCGACTATCTTCATCGGCTCACTCGTAATAGCTGGGATCTTATTGATGACTTTACTAACCGCATTGACAGTAATGCTACAGTCATGTCAA...

CDS

Download CDS FASTA

915 bp · LXL04_012294|LXL04_012294|OH1004|CDS

CTGAAGATGTCAGCATATGGCCATCAGATGGAACGGGAGCATTCTTCCCGGAGTCTCACAAGCGGTGAAGGATCTGAGATCGGAAGTCAATTTCGAATGGAATCGGTGATCTACATGTCATCATGTGCTGCGACTATCTTCATCGGCTCACTCGTAATAGCTGGGATCTTATTGATGACTTTACTAACCGCATTGACAGTAATGCTACAGTCATGTCAAAACAGAGAAGCTGGAGTTATCGAATCGTTCAAATATGATCA...

Protein

Download Protein FASTA

304 aa · LXL04_012294|LXL04_012294|OH1004|PROTEIN

MKMSAYGHQMEREHSSRSLTSGEGSEIGSQFRMESVIYMSSCAATIFIGSLVIAGILLMTLLTALTVMLQSCQNREAGVIESFKYDQCKMESQHAEINNFEAHSSPEFCKEVAVKYIKEGHYMRELNASVSLIENYFNGVRPDDSGHDVVLMDIDDFLPADTLRITPLSYGYNRYDWDDCVRESKHMKHVFLIELYIKLKSGGWPMILLSRKPEKMRDAIVEDLTSAGCDGWSRLIMRSMEEMKMDTRDYFSRRKMAIQK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012294`
TK1151 ID	TkA02G572670
OH-1004 ID	LXL04_012294
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 99.342 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012294

Location Chr03:9881443-9882697 (+)

Description Similar to At2g39920: Uncharacterized protein At2g39920

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39920`	Uncharacterized protein At2g39920.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012294 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0016020 membrane Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0045735 nutrient reservoir activity Molecular Function

KEGG gene cross-reference

ath:AT2G39920

gmx:547821

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.414

Rank 1 · LXL04_012294 · OH-1004

Lysosome / Vacuole0.196

Rank 2 · LXL04_012294 · OH-1004

Cytoplasm0.190

Rank 3 · LXL04_012294 · OH-1004

Endoplasmic reticulum0.150

Rank 4 · LXL04_012294 · OH-1004

Nucleus0.122

Rank 5 · LXL04_012294 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03767.21Acid_phosphat_B84-293 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012294	`PF03767.21`	Acid_phosphat_B	84	293	7.6e-21	75.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04195`	Arabidopsis thaliana	Uncharacterized protein At2g39920	41.414%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card