LXL04_009859 | RubberDandelionOmics

Gene overview

LXL04_009859

Reference: OH-1004 Chr: Chr02 Coordinates: 135071013-135072257 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

687 bp · LXL04_009859|LXL04_009859|OH1004|cDNA

ATGATTCTTGTTGTTCCAGCACTTCTTTATGCTATCAATAACTACTTAAAGTTCATCATGCAGCTCTATTTCAATCCAACAACTGTTAAGATGCTAAGCAATCTGAAAGTTTTAGTAATTGCGATTTTGTTAAGGATAATAATGAAGCGTCGGTTTTCCGTTATTCAGTGGGAGGCTCTTGCCCTATTGCTTATTGGAATCAGCATAACTCAAATGCAAGCTTTACCAAAGGACAGTAGTGGAATAGGTGTACCAGTTGC...

CDS

Download CDS FASTA

687 bp · LXL04_009859|LXL04_009859|OH1004|CDS

ATGATTCTTGTTGTTCCAGCACTTCTTTATGCTATCAATAACTACTTAAAGTTCATCATGCAGCTCTATTTCAATCCAACAACTGTTAAGATGCTAAGCAATCTGAAAGTTTTAGTAATTGCGATTTTGTTAAGGATAATAATGAAGCGTCGGTTTTCCGTTATTCAGTGGGAGGCTCTTGCCCTATTGCTTATTGGAATCAGCATAACTCAAATGCAAGCTTTACCAAAGGACAGTAGTGGAATAGGTGTACCAGTTGC...

Protein

Download Protein FASTA

229 aa · LXL04_009859|LXL04_009859|OH1004|PROTEIN

MILVVPALLYAINNYLKFIMQLYFNPTTVKMLSNLKVLVIAILLRIIMKRRFSVIQWEALALLLIGISITQMQALPKDSSGIGVPVAMGAYIYTFVFVTVPSLASVCNEYALKSQYDTSIYLQNLFSYGYGAIFNFLGILGTVVLKGPESFDILRGHSKATMLLIINNAGQGILYSFFLQICRYNFEKVFVNCCHDLHRLCICCFVWSYFDYKFHARNFYCFYLNAPGM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009859`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009859

Location Chr02:135071013-135072257 (+)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43240`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release
`At3g59360`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0604300`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release
`UniProt: Q7X7C4`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release
`UniProt: Q01IU9`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009859 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015739 sialic acid transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015136 sialic acid transmembrane transporter activity Molecular Function

GO:0015165 pyrimidine nucleotide-sugar transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G43240

ath:AT3G59360

dosa:Os02g0604300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.593

Rank 1 · LXL04_009859 · OH-1004

Endoplasmic reticulum0.312

Rank 2 · LXL04_009859 · OH-1004

Cytoplasm0.106

Rank 3 · LXL04_009859 · OH-1004

Lysosome / Vacuole0.050

Rank 4 · LXL04_009859 · OH-1004

Cell membrane0.046

Rank 5 · LXL04_009859 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04142.22Nuc_sug_transp3-180 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009859	`PF04142.22`	Nuc_sug_transp	3	180	1e-15	58.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GY97`	Arabidopsis thaliana	CMP-sialic acid transporter 2	79.444%	Swiss-Prot	strong database homology
`Q9C5H6`	Arabidopsis thaliana	CMP-sialic acid transporter 3	77.222%	Swiss-Prot	strong database homology
`Q6K8S7`	Oryza sativa subsp. japonica	CMP-sialic acid transporter 5	79.330%	Swiss-Prot	strong database homology
`Q7X7C4`	Oryza sativa subsp. japonica	CMP-sialic acid transporter 4	77.095%	Swiss-Prot	strong database homology
`Q01IU9`	Oryza sativa subsp. indica	CMP-sialic acid transporter 4	76.536%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card