LXL04_008469 | RubberDandelionOmics

Gene overview

LXL04_008469

Reference: OH-1004 Chr: Chr02 Coordinates: 100453335-100456146 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1629 bp · LXL04_008469|LXL04_008469|OH1004|cDNA

ATGCTAACTCAGGTTTATGCTCTTACAAGAGAAAGGGATATGCTACGCAAAGAGCAAAATAAGAGAAGTGATGCTACTGCTCTTCTAAAGGAAAAAGATGAAATAATCACTCAAGTTATGGCAGAAGGTGAAATGCTTTCAAAGAAACAAGCTGTTCAAGAATCTACAATTAGGAAACTACGTGCACAGATTAGAGAGTTTGATGAAGAGAAGAAAGGATTGATAAGCAAGATACAGGCTGAAGAAAGCAAAGTGGAGAG...

CDS

Download CDS FASTA

1629 bp · LXL04_008469|LXL04_008469|OH1004|CDS

ATGCTAACTCAGGTTTATGCTCTTACAAGAGAAAGGGATATGCTACGCAAAGAGCAAAATAAGAGAAGTGATGCTACTGCTCTTCTAAAGGAAAAAGATGAAATAATCACTCAAGTTATGGCAGAAGGTGAAATGCTTTCAAAGAAACAAGCTGTTCAAGAATCTACAATTAGGAAACTACGTGCACAGATTAGAGAGTTTGATGAAGAGAAGAAAGGATTGATAAGCAAGATACAGGCTGAAGAAAGCAAAGTGGAGAG...

Protein

Download Protein FASTA

542 aa · LXL04_008469|LXL04_008469|OH1004|PROTEIN

MLTQVYALTRERDMLRKEQNKRSDATALLKEKDEIITQVMAEGEMLSKKQAVQESTIRKLRAQIREFDEEKKGLISKIQAEESKVESLKSEKATTEKVLQETKEKNQSEITTQKEYYMNALSVAKEAKAEAEARANDEAKTELESHLREVEEREFMLIQTLEELRQTLCRKEQQEVFREDMLRREIDDLQKRYQVSERRCEELVMQVPESTRPLLRQIEAMQETTARKAETWAAMERSLNIRLQDAETKAVAIEEKHRAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008469`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008469

Location Chr02:100453335-100456146 (-)

Description Similar to GC5: Golgin candidate 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79830`	Golgi matrix protein playing a role in tethering of vesicles to Golgi membranes and in maintaining the overall structure of the Golgi apparatus.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008469 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001675 acrosome assembly Biological Process

GO:0001819 positive regulation of cytokine production Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0007286 spermatid development Biological Process

GO:0007289 spermatid nucleus differentiation Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0030317 flagellated sperm motility Biological Process

GO:0030521 androgen receptor signaling pathway Biological Process

GO:0032275 luteinizing hormone secretion Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0061136 regulation of proteasomal protein catabolic process Biological Process

KEGG gene cross-reference

ath:AT1G79830

hsa:7110

mmu:232286

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.672

Rank 1 · LXL04_008469 · OH-1004

Golgi apparatus0.263

Rank 2 · LXL04_008469 · OH-1004

Nucleus0.137

Rank 3 · LXL04_008469 · OH-1004

Cell membrane0.083

Rank 4 · LXL04_008469 · OH-1004

Lysosome / Vacuole0.065

Rank 5 · LXL04_008469 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12329.14TMF_DNA_bd24-96 aa

PF12325.14TMF_TATA_bd424-529 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008469	`PF12329.14`	TMF_DNA_bd	24	96	1.9e-14	54.1
LXL04_008469	`PF12325.14`	TMF_TATA_bd	424	529	2.5e-27	96.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WVL7`	Arabidopsis thaliana	Golgin candidate 5	69.780%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card