LXL04_006011 | RubberDandelionOmics

Gene overview

LXL04_006011

Reference: OH-1004 Chr: Chr01 Coordinates: 176950720-176955451 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

900 bp · LXL04_006011|LXL04_006011|OH1004|cDNA

ATGACGTTATTACTCCGTGGTTTTTGTAAACCTTGTCGTTATCTTCAACCCcttcatcaacatatatctCAATCCATTTCCTCACCCCCAAACCCTAGTTTACACAGACAAAATCACGAATTTTACATCCCCAACAAGTTGAAATACTTTAATTTGATAAGATTAGGTCAGGGTTATGGCATTTCCACTTCTTCAAGGATGAGGAAAAGGAAAAACGTAATGATTTCTTGGATTGATTTGTATTTGCCTGAAAACATTCG...

CDS

Download CDS FASTA

900 bp · LXL04_006011|LXL04_006011|OH1004|CDS

ATGACGTTATTACTCCGTGGTTTTTGTAAACCTTGTCGTTATCTTCAACCCCTTCATCAACATATATCTCAATCCATTTCCTCACCCCCAAACCCTAGTTTACACAGACAAAATCACGAATTTTACATCCCCAACAAGTTGAAATACTTTAATTTGATAAGATTAGGTCAGGGTTATGGCATTTCCACTTCTTCAAGGATGAGGAAAAGGAAAAACGTAATGATTTCTTGGATTGATTTGTATTTGCCTGAAAACATTCG...

Protein

Download Protein FASTA

299 aa · LXL04_006011|LXL04_006011|OH1004|PROTEIN

MTLLLRGFCKPCRYLQPLHQHISQSISSPPNPSLHRQNHEFYIPNKLKYFNLIRLGQGYGISTSSRMRKRKNVMISWIDLYLPENIRPYAHLARLVKPIGTWLLAWPFVMICRSITLAASPGHLPDMKMFTLFVTFAVRFDYGINSNSFFCQPNKYHATYHPLFLSNFIIHAYYGGHTDVYKPFGGLACFQVQALAVEASRQKRAAKEKVVACATVCTIPALSLAVAHYHRQCYFPPPSALLACYPPSPPALLLHQPQWF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006011`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006011

Location Chr01:176950720-176955451 (-)

Description Similar to PPT1: 4-hydroxybenzoate polyprenyltransferase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23660`	Catalyzes the prenylation of para-hydroxybenzoate (PHB) with an all-trans polyprenyl group.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006011 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0008299 isoprenoid biosynthetic process Biological Process

GO:0009625 response to insect Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0004337 (2E,6E)-farnesyl diphosphate synthase activity Molecular Function

GO:0004659 prenyltransferase activity Molecular Function

GO:0008412 4-hydroxybenzoate polyprenyltransferase activity Molecular Function

GO:0016765 transferase activity, transferring alkyl or aryl (other than methyl) groups Molecular Function

KEGG gene cross-reference

ag:BAB84122

ag:BAB84123

ath:AT4G23660

bta:504633

ddi:DDB_G0281241

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.683

Rank 1 · LXL04_006011 · OH-1004

Plastid0.128

Rank 2 · LXL04_006011 · OH-1004

Nucleus0.120

Rank 3 · LXL04_006011 · OH-1004

Cytoplasm0.083

Rank 4 · LXL04_006011 · OH-1004

Cell membrane0.030

Rank 5 · LXL04_006011 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YP7`	Arabidopsis thaliana	4-hydroxybenzoate polyprenyltransferase, mitochondrial	67.241%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card