LXL04_005908 | RubberDandelionOmics

Gene overview

LXL04_005908

Reference: OH-1004 Chr: Chr01 Coordinates: 175562232-175563910 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

900 bp · LXL04_005908|LXL04_005908|OH1004|cDNA

ATGTCCTTCGATCTTCCACCGGAGGTGTTGGAAGTGCTTCCTTCCGATCCATTTGAACAGCTCGATATCGCACGCAGAATCACTTCCATTGCGCTTTGCACTCGAATCACCTCCCTTGAATCGGAGTCCTCCGCCCTCCGCGACGAGCTTAACGACAGGGAACTTGTTGTCGAAGACCTGCAGACTCAAATTGACTCTCTTAACTCTTCTCTCTCCGACGTTTTCGACCAACTTTCCCGCGCTGATCAAGAGAAAGAGAA...

CDS

Download CDS FASTA

900 bp · LXL04_005908|LXL04_005908|OH1004|CDS

ATGTCCTTCGATCTTCCACCGGAGGTGTTGGAAGTGCTTCCTTCCGATCCATTTGAACAGCTCGATATCGCACGCAGAATCACTTCCATTGCGCTTTGCACTCGAATCACCTCCCTTGAATCGGAGTCCTCCGCCCTCCGCGACGAGCTTAACGACAGGGAACTTGTTGTCGAAGACCTGCAGACTCAAATTGACTCTCTTAACTCTTCTCTCTCCGACGTTTTCGACCAACTTTCCCGCGCTGATCAAGAGAAAGAGAA...

Protein

Download Protein FASTA

299 aa · LXL04_005908|LXL04_005908|OH1004|PROTEIN

MSFDLPPEVLEVLPSDPFEQLDIARRITSIALCTRITSLESESSALRDELNDRELVVEDLQTQIDSLNSSLSDVFDQLSRADQEKENLLNENASLSEQVNKLNRDVAKLQSFRKTLMMSLQDDEGNSQMIILSNLQARNKKPPVIAPLSEDEQTSYQDEPVKDASRTQATTPGLFLTPPGSPPSVSASGSPTRRHSVSFSTTRNMSDDRSSSSSIFSSTTSTPYTSMAGRTRVDGKEFFRQVRGRLSYDQFGAFLANVKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005908`
TK1151 ID	TkA01G007850
OH-1004 ID	LXL04_005908
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.500
Protein coverage (%)	TK1151 98.587 / OH-1004 96.321 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005908

Location Chr01:175562232-175563910 (-)

Description Similar to At4g15545: Uncharacterized protein At4g15545

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15545`	Uncharacterized protein At4g15545.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005908 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0080119 ER body organization Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0010168 ER body Cellular Component

KEGG gene cross-reference

ath:AT4G15545

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.744

Rank 1 · LXL04_005908 · OH-1004

Nucleus0.286

Rank 2 · LXL04_005908 · OH-1004

Golgi apparatus0.068

Rank 3 · LXL04_005908 · OH-1004

Lysosome / Vacuole0.067

Rank 4 · LXL04_005908 · OH-1004

Cell membrane0.064

Rank 5 · LXL04_005908 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25972.1At4g15545_C232-297 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005908	`PF25972.1`	At4g15545_C	232	297	7.3e-33	113.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93W28`	Arabidopsis thaliana	Uncharacterized protein At4g15545	56.535%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card