LXL04_005687 | RubberDandelionOmics

Gene overview

LXL04_005687

Reference: OH-1004 Chr: Chr01 Coordinates: 170850193-170853075 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1476 bp · LXL04_005687|LXL04_005687|OH1004|cDNA

ATGGCTGTTAACAAAACTTCTTTCTGTACCTCTCTAGATCTTATTCCTTCACACAAGCAACGAAGCTTCCCGGCGTTCGTTATCTACGATCCCGATCATCGTTACACCTTCGCTCCGACTTTTCTTTCCACAGACAATTCCACTGAATCAGGTTTATGTGCTATTCTATTCCATTTCATTTATTGCTTGATGTTTGTTTTCAGCATAAACATGTCGTCATCAAATCTTCCAGCTACAACCGAATCACTTGACCTTGCTTC...

CDS

Download CDS FASTA

1476 bp · LXL04_005687|LXL04_005687|OH1004|CDS

ATGGCTGTTAACAAAACTTCTTTCTGTACCTCTCTAGATCTTATTCCTTCACACAAGCAACGAAGCTTCCCGGCGTTCGTTATCTACGATCCCGATCATCGTTACACCTTCGCTCCGACTTTTCTTTCCACAGACAATTCCACTGAATCAGGTTTATGTGCTATTCTATTCCATTTCATTTATTGCTTGATGTTTGTTTTCAGCATAAACATGTCGTCATCAAATCTTCCAGCTACAACCGAATCACTTGACCTTGCTTC...

Protein

Download Protein FASTA

491 aa · LXL04_005687|LXL04_005687|OH1004|PROTEIN

MAVNKTSFCTSLDLIPSHKQRSFPAFVIYDPDHRYTFAPTFLSTDNSTESGLCAILFHFIYCLMFVFSINMSSSNLPATTESLDLASEAKNRPEAITILYRILDNPASSSEALRVKEQAIAKLSELLREENRGEDLRGLLTTLRPFFSLIPKAKTAKIVRGIIDSVAKIPNTTDLQISLCKEMVEWTRSEKRTFLRQRVEARLAALLMDSKEYSEALTLLSGLVKEVRRLDDKLLLVDIDLLESKLHFSLRNLPKAKAAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005687`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005687

Location Chr01:170850193-170853075 (-)

Description Similar to RPN6: 26S proteasome non-ATPase regulatory subunit 11 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29150`	Component of the lid subcomplex of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005687 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0043248 proteasome assembly Biological Process

GO:0048863 stem cell differentiation Biological Process

GO:0061136 regulation of proteasomal protein catabolic process Biological Process

GO:0071357 cellular response to type I interferon Biological Process

GO:0000502 proteasome complex Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G29150

hsa:5717

mmu:69077

rno:303353

xtr:100492225

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.656

Rank 1 · LXL04_005687 · OH-1004

Nucleus0.425

Rank 2 · LXL04_005687 · OH-1004

Golgi apparatus0.074

Rank 3 · LXL04_005687 · OH-1004

Endoplasmic reticulum0.071

Rank 4 · LXL04_005687 · OH-1004

Peroxisome0.053

Rank 5 · LXL04_005687 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18055.9RPN6_N89-209 aa

PF01399.34PCI374-455 aa

PF18503.8RPN6_C_helix462-487 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005687	`PF18055.9`	RPN6_N	89	209	1.3e-40	139.4
LXL04_005687	`PF01399.34`	PCI	374	455	4.1e-19	69.3
LXL04_005687	`PF18503.8`	RPN6_C_helix	462	487	1.1e-11	45.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LP45`	Arabidopsis thaliana	26S proteasome non-ATPase regulatory subunit 11 homolog	85.542%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card