LXL04_005504 | RubberDandelionOmics

Gene overview

LXL04_005504

Reference: OH-1004 Chr: Chr01 Coordinates: 165700794-165703258 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1218 bp · LXL04_005504|LXL04_005504|OH1004|cDNA

ATGGACGCCGCTAAGCTAGAGCAACTAAAGGTATTTATCAGCCGGTGCAAGTCCGATCCCTCCATTCTTAGCGATCCTTCACTCTCCTTCTTCCGCGACTATCTTGAAAGCCTCGGAGCTAAACTTCCGTCATCTGCTTACAAGAGTGAATCGCAATCGAAGCCTTACGTGGTGGAAGAGGACGAGGAAGTTGTTGAAGAACCTGAAGTAGAAGAGGATGAGATAATAGAATCCGACATTGAATTTGAAGGTGAAACTGT...

CDS

Download CDS FASTA

1218 bp · LXL04_005504|LXL04_005504|OH1004|CDS

ATGGACGCCGCTAAGCTAGAGCAACTAAAGGTATTTATCAGCCGGTGCAAGTCCGATCCCTCCATTCTTAGCGATCCTTCACTCTCCTTCTTCCGCGACTATCTTGAAAGCCTCGGAGCTAAACTTCCGTCATCTGCTTACAAGAGTGAATCGCAATCGAAGCCTTACGTGGTGGAAGAGGACGAGGAAGTTGTTGAAGAACCTGAAGTAGAAGAGGATGAGATAATAGAATCCGACATTGAATTTGAAGGTGAAACTGT...

Protein

Download Protein FASTA

405 aa · LXL04_005504|LXL04_005504|OH1004|PROTEIN

MDAAKLEQLKVFISRCKSDPSILSDPSLSFFRDYLESLGAKLPSSAYKSESQSKPYVVEEDEEVVEEPEVEEDEIIESDIEFEGETVEPDNDPPQKMGDSSVEVSEENRDASQEAKSKGMEAISDGKLEEAIEHLTEAILLNPTSAIMYATRASVYIKMKKPNAAIRDADAALQINPDSAKGYKSRGIALAMLGQWEKAAKDLHVASNIDFDEEISFILKKVEPNAHKIVEHRRKYDKLRKEKEERKTERERQRRRAEAK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005504`
TK1151 ID	TkA01G041160
OH-1004 ID	LXL04_005504
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005504

Location Chr01:165700794-165703258 (+)

Description Similar to At4g22670: FAM10 family protein At4g22670

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g22670`	FAM10 family protein At4g22670.	No verified direct reference in this release
`UniProt: Q8VWG7`	Thiol-disulfide oxidoreductase that possesses insulin disulfide bonds reducing activity, disulfide reductase, foldase chaperone and holdase chaperone activities.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0401200`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions and act as chaperone under heat shock.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005504 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0006950 response to stress Biological Process

GO:0010286 heat acclimation Biological Process

GO:0051259 protein complex oligomerization Biological Process

GO:0000118 histone deacetylase complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0016667 oxidoreductase activity, acting on a sulfur group of donors Molecular Function

GO:0016671 oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor Molecular Function

GO:0030544 Hsp70 protein binding Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT3G17880

ath:AT4G22670

dosa:Os09g0401200

gga:418003

osa:4346999

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.711

Rank 1 · LXL04_005504 · OH-1004

Nucleus0.460

Rank 2 · LXL04_005504 · OH-1004

Mitochondrion0.060

Rank 3 · LXL04_005504 · OH-1004

Endoplasmic reticulum0.042

Rank 4 · LXL04_005504 · OH-1004

Cell membrane0.037

Rank 5 · LXL04_005504 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18253.7HipN2-43 aa

PF13414.13TPR_11125-159 aa

PF00515.35TPR_1149-178 aa

PF13371.13TPR_9156-204 aa

PF17830.7STI1-HOP_DP350-399 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005504	`PF18253.7`	HipN	2	43	1.9e-17	63.4
LXL04_005504	`PF13414.13`	TPR_11	125	159	4.9e-09	36.5
LXL04_005504	`PF00515.35`	TPR_1	149	178	1.4e-13	50.8
LXL04_005504	`PF13371.13`	TPR_9	156	204	2.9e-10	40.7
LXL04_005504	`PF17830.7`	STI1-HOP_DP	350	399	3.2e-13	50.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YR3`	Arabidopsis thaliana	FAM10 family protein At4g22670	68.647%	Swiss-Prot	strong database homology
`Q8VWG7`	Arabidopsis thaliana	TPR repeat-containing thioredoxin TDX	58.271%	Swiss-Prot	moderate database homology
`Q6ES52`	Oryza sativa subsp. japonica	TPR repeat-containing thioredoxin TDX	71.739%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card