LXL04_004443 | RubberDandelionOmics

Gene overview

LXL04_004443

Reference: OH-1004 Chr: Chr01 Coordinates: 136285532-136288411 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2880 bp · LXL04_004443|LXL04_004443|OH1004|cDNA

ATGAATGAAAGCTACAATGCTTCATGTCTCTTTTATAAACCGCCAAATGCCAACCACCTTTCGAAGATGGAGGTTCCTTTATCTGTAACCCTCCAAAAGCTTCCTTTTATCCCATCACAAACCCATGAATTAAAACAGTGGAACTCCACAATCAAGCACCACACGAAGCTAAAAGATGACCGCGCTATACTCACTACATATACGCAGATGGAATCTTTGGGTATTTTGCCGGATAATACCACTTTGCCGCTGGTACTCAA...

CDS

Download CDS FASTA

2880 bp · LXL04_004443|LXL04_004443|OH1004|CDS

ATGAATGAAAGCTACAATGCTTCATGTCTCTTTTATAAACCGCCAAATGCCAACCACCTTTCGAAGATGGAGGTTCCTTTATCTGTAACCCTCCAAAAGCTTCCTTTTATCCCATCACAAACCCATGAATTAAAACAGTGGAACTCCACAATCAAGCACCACACGAAGCTAAAAGATGACCGCGCTATACTCACTACATATACGCAGATGGAATCTTTGGGTATTTTGCCGGATAATACCACTTTGCCGCTGGTACTCAA...

Protein

Download Protein FASTA

959 aa · LXL04_004443|LXL04_004443|OH1004|PROTEIN

MNESYNASCLFYKPPNANHLSKMEVPLSVTLQKLPFIPSQTHELKQWNSTIKHHTKLKDDRAILTTYTQMESLGILPDNTTLPLVLKACGKLQAIEKGKKLHNAILTTNLASDIRIQTALVDFYSKCGMLQNALNVFDEMTERDVVSWNAMISGCVSCSEYQKSLQLFSQMQKDNLKANSVTLVQLLQISGELLELRSGKEIHGYCLRHDFNTNPHVCSSLMGFYIKFDPWIASLVFETLSSRNTITWNTMITGYIDHGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004443`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004443

Location Chr01:136285532-136288411 (-)

Description Similar to PCMP-H81: Pentatricopeptide repeat-containing protein At3g57430, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g57430`	Involved in RNA editing events in chloroplasts.	A study of new Arabidopsis chloroplast RNA editing mutants reveals general features of editing factors and their target sites.2009 · DOI: 10.1105/tpc.109.071472
`At4g13650`	Pentatricopeptide repeat-containing protein At4g13650.	No verified direct reference in this release
`At2g27610`	Pentatricopeptide repeat-containing protein At2g27610.	No verified direct reference in this release
`At3g63370`	Involved in RNA editing event in chloroplasts.	A study of new Arabidopsis chloroplast RNA editing mutants reveals general features of editing factors and their target sites.2009 · DOI: 10.1105/tpc.109.071472
`At4g18750`	Plays a major role in single RNA editing events in chloroplasts.	Identification of two pentatricopeptide repeat genes required for RNA editing and zinc binding by C-terminal cytidine deaminase-like domains.2013 · DOI: 10.1074/jbc.m113.485755

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004443 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0031425 chloroplast RNA processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G57430

ath:AT4G13650

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.629

Rank 1 · LXL04_004443 · OH-1004

Plastid0.237

Rank 2 · LXL04_004443 · OH-1004

Nucleus0.046

Rank 3 · LXL04_004443 · OH-1004

Cytoplasm0.030

Rank 4 · LXL04_004443 · OH-1004

Cell membrane0.006

Rank 5 · LXL04_004443 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_2143-186 aa

PF01535.27PPR146-175 aa

PF13041.13PPR_2243-290 aa

PF01535.27PPR246-276 aa

PF13041.13PPR_2343-388 aa

PF13041.13PPR_2651-699 aa

PF01535.27PPR654-684 aa

PF13812.13PPR_3676-732 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004443	`PF13041.13`	PPR_2	143	186	1.2e-69	230.9
LXL04_004443	`PF01535.27`	PPR	146	175	6.2e-53	174.1
LXL04_004443	`PF13041.13`	PPR_2	243	290	1.2e-69	230.9
LXL04_004443	`PF01535.27`	PPR	246	276	6.2e-53	174.1
LXL04_004443	`PF13041.13`	PPR_2	343	388	1.2e-69	230.9
LXL04_004443	`PF13041.13`	PPR_2	651	699	1.2e-69	230.9
LXL04_004443	`PF01535.27`	PPR	654	684	6.2e-53	174.1
LXL04_004443	`PF13812.13`	PPR_3	676	732	1.8e-21	76.7
LXL04_004443	`PF20431.5`	E_motif	769	830	1.5e-19	70.7
LXL04_004443	`PF14432.13`	DYW_deaminase	867	959	2.4e-38	130.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7Y211`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g57430, chloroplastic	35.379%	Swiss-Prot	moderate database homology
`Q9SVP7`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g13650	33.224%	Swiss-Prot	moderate database homology
`Q9ZUW3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g27610	33.692%	Swiss-Prot	moderate database homology
`Q9M1V3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g63370, chloroplastic	32.463%	Swiss-Prot	moderate database homology
`Q9SN39`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein DOT4, chloroplastic	35.128%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card