LXL04_002682 | RubberDandelionOmics

Gene overview

LXL04_002682

Reference: OH-1004 Chr: Chr01 Coordinates: 54558284-54562495 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2409 bp · LXL04_002682|LXL04_002682|OH1004|cDNA

ATGGCCCAGATATTGCTACATGGAACATTTCATGCGACAATCTTTGAAGTAGACAAACTCAAGTCCAATTTGCTTCATAAGATCGTAGATGGACTAGAGCATGTTGTGGGATTAAAGAACAAGGGCCAAAGCCTTTACGCAACGGTGGACCTAGAAAAAGCTCGAGTGGGCCGAACCCGAATGCTGGAACACGACTCAAACCCACGATGGTTTGAGTCATTCCATATCTACTGTGCCCACATGGCCTCTAATGTCGTCTT...

CDS

Download CDS FASTA

2409 bp · LXL04_002682|LXL04_002682|OH1004|CDS

ATGGCCCAGATATTGCTACATGGAACATTTCATGCGACAATCTTTGAAGTAGACAAACTCAAGTCCAATTTGCTTCATAAGATCGTAGATGGACTAGAGCATGTTGTGGGATTAAAGAACAAGGGCCAAAGCCTTTACGCAACGGTGGACCTAGAAAAAGCTCGAGTGGGCCGAACCCGAATGCTGGAACACGACTCAAACCCACGATGGTTTGAGTCATTCCATATCTACTGTGCCCACATGGCCTCTAATGTCGTCTT...

Protein

Download Protein FASTA

802 aa · LXL04_002682|LXL04_002682|OH1004|PROTEIN

MAQILLHGTFHATIFEVDKLKSNLLHKIVDGLEHVVGLKNKGQSLYATVDLEKARVGRTRMLEHDSNPRWFESFHIYCAHMASNVVFTVKEDDSIGATVIGRAYISVTKLLNQEVIDEWLEIVDDRGKHVHGHSKIHVRVQFFKVERECQWSRGIQSVKFPGVPYTFFPQRNGCRVTLYQDAHLPNNFTPKIPLCGGKYYEPHRCWEDIFDAISNAKHLIYITGWSVYTEIALIRDLRRPKPGGDMTLGELLKKKASEGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002682`
TK1151 ID	TkA01G430310
OH-1004 ID	LXL04_002682
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002682

Location Chr01:54558284-54562495 (-)

Description Similar to PLD1: Phospholipase D alpha 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0172400`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002682 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009395 phospholipid catabolic process Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0034638 phosphatidylcholine catabolic process Biological Process

GO:0046470 phosphatidylcholine metabolic process Biological Process

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0004630 D-type glycerophospholipase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

dosa:Os01g0172400

nta:107779725

rcu:8282326

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.562

Rank 1 · LXL04_002682 · OH-1004

Cell membrane0.230

Rank 2 · LXL04_002682 · OH-1004

Nucleus0.225

Rank 3 · LXL04_002682 · OH-1004

Lysosome / Vacuole0.145

Rank 4 · LXL04_002682 · OH-1004

Golgi apparatus0.122

Rank 5 · LXL04_002682 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168.37C240-121 aa

PF00614.30PLDc212-790 aa

PF13091.13PLDc_2633-681 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002682	`PF00168.37`	C2	40	121	1.2e-09	39.0
LXL04_002682	`PF00614.30`	PLDc	212	790	5.5e-230	765.2
LXL04_002682	`PF13091.13`	PLDc_2	633	681	4.3e-10	40.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q43007`	Oryza sativa subsp. japonica	Phospholipase D alpha 1	71.956%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card