LXL04_000743 | RubberDandelionOmics

Gene overview

LXL04_000743

Reference: OH-1004 Chr: Chr01 Coordinates: 13769941-13773570 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2172 bp · LXL04_000743|LXL04_000743|OH1004|cDNA

ATGGATGGAGTAGCTGAAGGACTGTGGGAATTAGCGGATTTCCACGAGAAAAATGGCGAAATTGCGAAATCAATCAAGTGTCTTGAAGCCATTTGTCAAAGTACTGTCTCGTTTCTTCCCGTTATCGAAGTCAAAACTCGTCTTAGAATCGCTACTATGCTCCTCAAGCATTCTCAGAACGTTAATTATGCGAAATCTCACCTTGAACGATCCCAACTACTCTTAAAATCGATTCCCTCATGCTTCGAGTTGAAGTGCAG...

CDS

Download CDS FASTA

2172 bp · LXL04_000743|LXL04_000743|OH1004|CDS

ATGGATGGAGTAGCTGAAGGACTGTGGGAATTAGCGGATTTCCACGAGAAAAATGGCGAAATTGCGAAATCAATCAAGTGTCTTGAAGCCATTTGTCAAAGTACTGTCTCGTTTCTTCCCGTTATCGAAGTCAAAACTCGTCTTAGAATCGCTACTATGCTCCTCAAGCATTCTCAGAACGTTAATTATGCGAAATCTCACCTTGAACGATCCCAACTACTCTTAAAATCGATTCCCTCATGCTTCGAGTTGAAGTGCAG...

Protein

Download Protein FASTA

723 aa · LXL04_000743|LXL04_000743|OH1004|PROTEIN

MDGVAEGLWELADFHEKNGEIAKSIKCLEAICQSTVSFLPVIEVKTRLRIATMLLKHSQNVNYAKSHLERSQLLLKSIPSCFELKCRAFSLLSQCYHLVGAVSSQKQLLNKGLELTADFGEGFSGKLWACNFNSQLANALIIEGDYQGSVSALEQAYACATEMYYPELQMFFATSVLHVHLMQWDDGTLVENAVNRCNDIWESIDTDKRQQCLGLFFYNELLQIFYLLRICDYKAAGQHVDKLDAAMKTDLQKTQHTREL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000743`
TK1151 ID	TkA01G590490
OH-1004 ID	LXL04_000743
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000743

Location Chr01:13769941-13773570 (-)

Description Similar to SCC4: Sister chromatid cohesion protein SCC4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51340`	Essential protein required for cell fate determination during embryogenesis.	The Arabidopsis homolog of Scc4/MAU2 is essential for embryogenesis.2017 · DOI: 10.1242/jcs.196865

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000743 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007059 chromosome segregation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0034088 maintenance of mitotic sister chromatid cohesion Biological Process

GO:0051301 cell division Biological Process

GO:0000785 chromatin Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0032116 SMC loading complex Cellular Component

KEGG gene cross-reference

aag:5575408

ath:AT5G51340

cqu:CpipJ_CPIJ012302

dan:6500620

dwi:6650393

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.602

Rank 1 · LXL04_000743 · OH-1004

Nucleus0.242

Rank 2 · LXL04_000743 · OH-1004

Cell membrane0.141

Rank 3 · LXL04_000743 · OH-1004

Golgi apparatus0.135

Rank 4 · LXL04_000743 · OH-1004

Lysosome / Vacuole0.135

Rank 5 · LXL04_000743 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10345.16Cohesin_load21-628 aa

PF13424.13TPR_12532-603 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000743	`PF10345.16`	Cohesin_load	21	628	1.4e-27	97.0
LXL04_000743	`PF13424.13`	TPR_12	532	603	8.6e-07	29.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGN7`	Arabidopsis thaliana	Sister chromatid cohesion protein SCC4	57.931%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card