LXL04_000624 | RubberDandelionOmics

Gene overview

LXL04_000624

Reference: OH-1004 Chr: Chr01 Coordinates: 11334689-11336031 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

732 bp · LXL04_000624|LXL04_000624|OH1004|cDNA

ATGGGAAAGAACTATAAGGATTCGCTTAAAGCTCTCGAAGCTGATATACAACATGCCAATACTCTTGCATTAAATTCCCCCAAGGATGATAACGGAGCATGCCTTCAAATGAGACTCTATTTCAGTCCAGCTCTAGACTTGTTCTCCTATCTTTTTCCATGGGCAGATTGTAAGATTGCAGGCGCCCTTGGTTTGCTTCGTGTTTTCGTTTATCAGATACATGCTGATGGAAAAACTACCATGGATGTTCATGAAAGAAA...

CDS

Download CDS FASTA

732 bp · LXL04_000624|LXL04_000624|OH1004|CDS

ATGGGAAAGAACTATAAGGATTCGCTTAAAGCTCTCGAAGCTGATATACAACATGCCAATACTCTTGCATTAAATTCCCCCAAGGATGATAACGGAGCATGCCTTCAAATGAGACTCTATTTCAGTCCAGCTCTAGACTTGTTCTCCTATCTTTTTCCATGGGCAGATTGTAAGATTGCAGGCGCCCTTGGTTTGCTTCGTGTTTTCGTTTATCAGATACATGCTGATGGAAAAACTACCATGGATGTTCATGAAAGAAA...

Protein

Download Protein FASTA

243 aa · LXL04_000624|LXL04_000624|OH1004|PROTEIN

MGKNYKDSLKALEADIQHANTLALNSPKDDNGACLQMRLYFSPALDLFSYLFPWADCKIAGALGLLRVFVYQIHADGKTTMDVHERKASIRQFYTVVFPSIMQLQSGITDLEERKQNEICLKKFLRKNQGLEKGKQLDDDDDDDDDDDECGICMETNSKIVLPNCTHSLCFKCYRDWNARSRSCPFCRKTLKGVNLTDLWIYVEDSDTIDLTIISKENSERLFMYIQKLPLVVPKAIQSSNFR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000624`
TK1151 ID	TkA01G598800
OH-1004 ID	LXL04_000624
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000624

Location Chr01:11334689-11336031 (-)

Description Similar to AIRP2: E3 ubiquitin-protein ligase AIRP2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g01520`	Possesses E3 ubiquitin-protein ligase activity in vitro when associated with the E2 enzyme UBC8 in vitro.	The Arabidopsis RING E3 ubiquitin ligase AtAIRP2 plays combinatory roles with AtAIRP1 in abscisic acid-mediated drought stress responses.2011 · DOI: 10.1104/pp.111.185595 AtAIRP2 E3 Ligase Affects ABA and High-Salinity Responses by Stimulating Its ATP1/SDIRIP1 Substrate Turnover.2017 · DOI: 10.1104/pp.17.00467

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000624 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016020 membrane Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT5G01520

bta:539455

gga:423039

mmu:67150

pon:100173297

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.465

Rank 1 · LXL04_000624 · OH-1004

Nucleus0.453

Rank 2 · LXL04_000624 · OH-1004

Mitochondrion0.103

Rank 3 · LXL04_000624 · OH-1004

Cell membrane0.071

Rank 4 · LXL04_000624 · OH-1004

Endoplasmic reticulum0.055

Rank 5 · LXL04_000624 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13920.13zf-C3HC4_3147-193 aa

PF13639.13zf-RING_2148-188 aa

PF00097.32zf-C3HC4150-187 aa

PF14447.13Prok-RING_4150-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000624	`PF13920.13`	zf-C3HC4_3	147	193	4.1e-11	43.2
LXL04_000624	`PF13639.13`	zf-RING_2	148	188	1e-08	36.0
LXL04_000624	`PF00097.32`	zf-C3HC4	150	187	4.2e-06	27.2
LXL04_000624	`PF14447.13`	Prok-RING_4	150	191	7.9e-06	26.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M022`	Arabidopsis thaliana	E3 ubiquitin-protein ligase AIRP2	57.511%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card