LXL04_000106 | RubberDandelionOmics

Gene overview

LXL04_000106

Reference: OH-1004 Chr: Chr01 Coordinates: 2435120-2435674 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

555 bp · LXL04_000106|LXL04_000106|OH1004|cDNA

ATGGAAACGCCTACTAAACGACCTTTTCATAAATCCATTTCCAGTAACTCCTTCCACCTCCGTTCTCCCAGTCTCAATTCCGTCCGTCTCCGCCGTATCTTCGATCTCTACGACGCCAATCACGACTCCTTCATCACCGTCGACGAGATCAGCACTGCCTTAAAAACCCTCGGCCTCGACACCGACATCTCCGATTTGGATTCAATGATAAAGTCATACATCCATCCTGGCAACGCCGGCCTCACCTACGACGATTTCGT...

CDS

Download CDS FASTA

555 bp · LXL04_000106|LXL04_000106|OH1004|CDS

ATGGAAACGCCTACTAAACGACCTTTTCATAAATCCATTTCCAGTAACTCCTTCCACCTCCGTTCTCCCAGTCTCAATTCCGTCCGTCTCCGCCGTATCTTCGATCTCTACGACGCCAATCACGACTCCTTCATCACCGTCGACGAGATCAGCACTGCCTTAAAAACCCTCGGCCTCGACACCGACATCTCCGATTTGGATTCAATGATAAAGTCATACATCCATCCTGGCAACGCCGGCCTCACCTACGACGATTTCGT...

Protein

Download Protein FASTA

184 aa · LXL04_000106|LXL04_000106|OH1004|PROTEIN

METPTKRPFHKSISSNSFHLRSPSLNSVRLRRIFDLYDANHDSFITVDEISTALKTLGLDTDISDLDSMIKSYIHPGNAGLTYDDFVILHKSINDLLFGMEDLQLPGGNVTEQEESDLTEAFKVFDEDGDGFISATELQMVLGKLGFTEATEMESVKMMISSVDVNHDGQVDFSEFKDMMKALQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000106`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000106

Location Chr01:2435120-2435674 (-)

Description Similar to CML42: Calcium-binding protein CML42

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g20780`	Probable calcium sensor that binds calcium in vitro.	Calmodulin-like proteins from Arabidopsis and tomato are involved in host defense against Pseudomonas syringae pv. tomato.2005 · DOI: 10.1007/s11103-005-8395-x The calmodulin-related calcium sensor CML42 plays a role in trichome branching.2009 · DOI: 10.1074/jbc.m109.056770
`At5g44460`	Calcium-binding protein that may mediate calcium-dependent signal during plant defense response.	Calmodulin-like proteins from Arabidopsis and tomato are involved in host defense against Pseudomonas syringae pv. tomato.2005 · DOI: 10.1007/s11103-005-8395-x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0331700`	Potential calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000106 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010091 trichome branching Biological Process

GO:0051592 response to calcium ion Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005509 calcium ion binding Molecular Function

GO:0061891 calcium ion sensor activity Molecular Function

KEGG gene cross-reference

ath:AT4G20780

ath:AT5G44460

dosa:Os03g0331700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.653

Rank 1 · LXL04_000106 · OH-1004

Nucleus0.379

Rank 2 · LXL04_000106 · OH-1004

Cell membrane0.067

Rank 3 · LXL04_000106 · OH-1004

Endoplasmic reticulum0.056

Rank 4 · LXL04_000106 · OH-1004

Lysosome / Vacuole0.052

Rank 5 · LXL04_000106 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499.13EF-hand_729-88 aa

PF13405.13EF-hand_629-58 aa

PF00036.39EF-hand_130-57 aa

PF24548.2EF_EFCAB10_C31-65 aa

PF23564.2EF-hand_FSTL1113-181 aa

PF13499.13EF-hand_7115-181 aa

PF00036.39EF-hand_1118-144 aa

PF13405.13EF-hand_6118-146 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000106	`PF13499.13`	EF-hand_7	29	88	1.2e-24	87.2
LXL04_000106	`PF13405.13`	EF-hand_6	29	58	1e-21	75.2
LXL04_000106	`PF00036.39`	EF-hand_1	30	57	5.8e-23	79.4
LXL04_000106	`PF24548.2`	EF_EFCAB10_C	31	65	9.1e-08	32.4
LXL04_000106	`PF23564.2`	EF-hand_FSTL1	113	181	2.2e-07	32.0
LXL04_000106	`PF13499.13`	EF-hand_7	115	181	1.2e-24	87.2
LXL04_000106	`PF00036.39`	EF-hand_1	118	144	5.8e-23	79.4
LXL04_000106	`PF13405.13`	EF-hand_6	118	146	1e-21	75.2
LXL04_000106	`PF13202.13`	EF-hand_5	121	141	4.8e-16	58.1
LXL04_000106	`PF13833.13`	EF-hand_8	133	182	7.4e-08	32.7
LXL04_000106	`PF00036.39`	EF-hand_1	156	183	5.8e-23	79.4
LXL04_000106	`PF13202.13`	EF-hand_5	163	180	4.8e-16	58.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SVG9`	Arabidopsis thaliana	Calcium-binding protein CML42	55.789%	Swiss-Prot	strong database homology
`Q9FI19`	Arabidopsis thaliana	Probable calcium-binding protein CML43	58.721%	Swiss-Prot	strong database homology
`Q10LX4`	Oryza sativa subsp. japonica	Probable calcium-binding protein CML27	49.162%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card