LXL04_000034 | RubberDandelionOmics

Gene overview

LXL04_000034

Reference: OH-1004 Chr: Chr01 Coordinates: 691941-693585 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

891 bp · LXL04_000034|LXL04_000034|OH1004|cDNA

ATGGCTTCTCTCACACGTGTCTTACCAACCTCTTTACAGTTTCCTCACCACATTTCCACTCCTACCTGCACCAGAATCAGCACCTTTTCTACCACAACCAGAAGAAGATTCTCCGTTCTATCAATGGCGGAATCCAACCGCAGCACCGTCCTCGTCACCGGAGCTGGTGGCAGAACCGGTCAATTAGTTTACAAAAAGCTAAAGGAGAGATCAACTGAGTACATCGCAAGAGGTCTAGTCAGAACGGAGGAAAGCAAAGA...

CDS

Download CDS FASTA

891 bp · LXL04_000034|LXL04_000034|OH1004|CDS

ATGGCTTCTCTCACACGTGTCTTACCAACCTCTTTACAGTTTCCTCACCACATTTCCACTCCTACCTGCACCAGAATCAGCACCTTTTCTACCACAACCAGAAGAAGATTCTCCGTTCTATCAATGGCGGAATCCAACCGCAGCACCGTCCTCGTCACCGGAGCTGGTGGCAGAACCGGTCAATTAGTTTACAAAAAGCTAAAGGAGAGATCAACTGAGTACATCGCAAGAGGTCTAGTCAGAACGGAGGAAAGCAAAGA...

Protein

Download Protein FASTA

296 aa · LXL04_000034|LXL04_000034|OH1004|PROTEIN

MASLTRVLPTSLQFPHHISTPTCTRISTFSTTTRRRFSVLSMAESNRSTVLVTGAGGRTGQLVYKKLKERSTEYIARGLVRTEESKEKIGGADDVFIGDIRNTESILPAIQGIDALVILTSAVPKMKPGFDPSKGGRPEFYFEEGSNPEQVDWEGQKNQIEAAKAAGVKQIVLVGSMGGTNINHPLNSLGNGNILVWKRKAEQYLADSGIPYTIIRAGGLQDKEGGIRELLIGKDDELLETETKTVARPDVAEVCIQALK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000034`
TK1151 ID	TkA01G640430
OH-1004 ID	LXL04_000034
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000034

Location Chr01:691941-693585 (+)

Description Similar to At2g37660: Uncharacterized protein At2g37660, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37660`	Uncharacterized protein At2g37660, chloroplastic.	No verified direct reference in this release
`At5g02240`	Uncharacterized protein At5g02240.	No verified direct reference in this release
`At2g34460`	Uncharacterized protein At2g34460, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000034 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009636 response to toxic substance Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0015979 photosynthesis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009523 photosystem II Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ag:ADE41047

ath:AT2G34460

ath:AT2G37660

ath:AT5G02240

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.984

Rank 1 · LXL04_000034 · OH-1004

Mitochondrion0.033

Rank 2 · LXL04_000034 · OH-1004

Cytoplasm0.024

Rank 3 · LXL04_000034 · OH-1004

Peroxisome0.016

Rank 4 · LXL04_000034 · OH-1004

Nucleus0.013

Rank 5 · LXL04_000034 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368.20NmrA47-216 aa

PF13460.13NAD_binding_1054-260 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000034	`PF05368.20`	NmrA	47	216	1.1e-07	32.4
LXL04_000034	`PF13460.13`	NAD_binding_10	54	260	2.5e-32	113.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80934`	Arabidopsis thaliana	Uncharacterized protein At2g37660, chloroplastic	76.471%	Swiss-Prot	strong database homology
`Q94EG6`	Arabidopsis thaliana	Uncharacterized protein At5g02240	78.968%	Swiss-Prot	strong database homology
`Q8H124`	Arabidopsis thaliana	Uncharacterized protein At2g34460, chloroplastic	28.947%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card