TkA08G362640 | RubberDandelionOmics

Gene overview

TkA08G362640

Reference: TK1151 Chr: Chr08 Coordinates: 92912770-92914669 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1007 bp · TkA08G362640|TK1151|cDNA

GTCACGCCTAATTTCATACTTAGCCATCACTGTTCCGTCTCGTCCGCTCAATCGCGATGACCTCGACCGAATGGATCCCGTTGGTGCTACGAGTGCTCGAATTCGGAGACCAAACACAGCAATTGTTCAGTGTCAGGTGCAGTCCTCAAATCGCGGCGTATTATTTTCTCGACCTGCTTCTTACAGGGTTCGATGAAGATCGGAATTTGGAGAACGGGAGACAGGTGATTGCGATTGGAGGGTTGAGTTTGTTGTTGAGA...

CDS

Download CDS FASTA

1119 bp · TkA08G362640|TK1151|CDS

ATGACCTCGACCGAATGGATCCCGTTGGTGCTACGAGTGCTCGAATTCGGAGACCAAACACAGCAATTGTTCAGTGTCAGGTGCAGTCCTCAAATCGCGGCGTATTATTTTCTCGACCTGCTTCTTACAGGGTTCGATGAAGATCGGAATTTGGAGAACGGGAGACAGGTGATTGCGATTGGAGGGTTGAGTTTGTTGTTGAGAAGAATAGCGACTGGAGATGACGTCGAAAAGGGCAAAGCGGTTTCCGTGATTTATTG...

Protein

Download Protein FASTA

372 aa · TkA08G362640|TK1151|PROTEIN

MTSTEWIPLVLRVLEFGDQTQQLFSVRCSPQIAAYYFLDLLLTGFDEDRNLENGRQVIAIGGLSLLLRRIATGDDVEKGKAVSVIYCCIQSDGRCRHYLADNLNPELILALLVHDANETVFSLLIELICLHRFEQRTKLFNKLLKGWDCLNTLQILLVSLQWATQKKRPLIATIMLQLDLMADPLKSSVYREEAIEAITAALDCQICNENVQEETAKALLILGGRYSYTGTPEAKKWILKEAGYDESLEGGFHGRYFIVQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G362640`
TK1151 ID	TkA08G362640
OH-1004 ID	LXL04_034125
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.100
Protein coverage (%)	TK1151 93.280 / OH-1004 86.750 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G362640`
Location	Chr08:92912770-92914669 (+)
Description	Similar to LIN: Putative E3 ubiquitin-protein ligase LIN-2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034125` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009877 nodulation Biological Process GO:0016567 protein ubiquitination Biological Process GO:0061630 ubiquitin protein ligase activity Molecular Function
KEGG gene cross-reference	mtr:11418360 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.401

Rank 1 · TkA08G362640 · TK1151

Nucleus0.384

Rank 2 · TkA08G362640 · TK1151

Cell membrane0.205

Rank 3 · TkA08G362640 · TK1151

Endoplasmic reticulum0.082

Rank 4 · TkA08G362640 · TK1151

Golgi apparatus0.070

Rank 5 · TkA08G362640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23654ARM_LIN_2nd1-39 aa

PF23628ARM_LIN_C41-308 aa

PF17123zf-RING_1174-88 aa

PF17123zf-RING_11128-140 aa

PF23654ARM_LIN_2nd153-194 aa

PF17123zf-RING_11203-216 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G362640	`PF23654`	ARM_LIN_2nd	1	39	2.4e-08	34.5
TkA08G362640	`PF23628`	ARM_LIN_C	41	308	2.7e-81	274.1
TkA08G362640	`PF17123`	zf-RING_11	74	88	1.3	9.5
TkA08G362640	`PF17123`	zf-RING_11	128	140	1.3	9.5
TkA08G362640	`PF23654`	ARM_LIN_2nd	153	194	2.4e-08	34.5
TkA08G362640	`PF17123`	zf-RING_11	203	216	1.3	9.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card