TkA07G362590 | RubberDandelionOmics

Gene overview

TkA07G362590

Reference: TK1151 Chr: Chr07 Coordinates: 90836943-90838172 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1230 bp · TkA07G362590|TK1151|cDNA

ATGGCGAGAGAAAAAAGCAACGGGTTGCACCTGAGTGTTCCCAGCTTCTTCAAGTGCCCGATATCAATGGACGTCATGAAATCTCCGGTCAGTCTTTGTACCGGCGTTACCTATGACCGCGCCAGCATCCAGACGTGGCTCGATTCCGGCCACAATACATGTCCCGCCACCATGCAAGTCCTCCAATCCACCGATGTCGTCCCTAACCTCACACTCCGCCGTCTCATTCGTGTCTGGTCTGATTCCTATCTCCTAACCCC...

CDS

Download CDS FASTA

1230 bp · TkA07G362590|TK1151|CDS

ATGGCGAGAGAAAAAAGCAACGGGTTGCACCTGAGTGTTCCCAGCTTCTTCAAGTGCCCGATATCAATGGACGTCATGAAATCTCCGGTCAGTCTTTGTACCGGCGTTACCTATGACCGCGCCAGCATCCAGACGTGGCTCGATTCCGGCCACAATACATGTCCCGCCACCATGCAAGTCCTCCAATCCACCGATGTCGTCCCTAACCTCACACTCCGCCGTCTCATTCGTGTCTGGTCTGATTCCTATCTCCTAACCCC...

Protein

Download Protein FASTA

409 aa · TkA07G362590|TK1151|PROTEIN

MAREKSNGLHLSVPSFFKCPISMDVMKSPVSLCTGVTYDRASIQTWLDSGHNTCPATMQVLQSTDVVPNLTLRRLIRVWSDSYLLTPESHASFNNHLAFDSVKKMISSEQTQQLSLGTLSSIITFAKLSIENRESLAKLDGFVPKLSRNLKVSNEIEVVELLVTALDLILPEKGVKEQLINLNSEDASLSPFSFVLQKGGLEARISAARVLESLAAFDNESRRVIADQSTLLKELYRLASSETEPRAVEAGFSALIIVST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G362590`
TK1151 ID	TkA07G362590
OH-1004 ID	LXL04_029955
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G362590

Location Chr07:90836943-90838172 (-)

Description Similar to PUB28: U-box domain-containing protein 28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g09800`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At3g18710`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g64660`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At3g49810`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At5g65920`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029955 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:1900457 regulation of brassinosteroid mediated signaling pathway Biological Process

GO:1901001 negative regulation of response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

GO:0070696 transmembrane receptor protein serine/threonine kinase binding Molecular Function

KEGG gene cross-reference

ath:AT3G18710

ath:AT3G49810

ath:AT5G09800

ath:AT5G64660

dosa:Os03g0232600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.579

Rank 1 · TkA07G362590 · TK1151

Cytoplasm0.436

Rank 2 · TkA07G362590 · TK1151

Cell membrane0.070

Rank 3 · TkA07G362590 · TK1151

Endoplasmic reticulum0.031

Rank 4 · TkA07G362590 · TK1151

Lysosome / Vacuole0.028

Rank 5 · TkA07G362590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04564U-box13-80 aa

PF11789zf-Nse17-56 aa

PF13923zf-C3HC4_218-55 aa

PF13445zf-RING_UBOX19-55 aa

PF15227zf-C3HC4_419-55 aa

PF24768ARM_ARMC553-138 aa

PF25598ARM_PUB107-406 aa

PF24768ARM_ARMC5207-352 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G362590	`PF04564`	U-box	13	80	2.8e-18	66.5
TkA07G362590	`PF11789`	zf-Nse	17	56	0.0046	17.5
TkA07G362590	`PF13923`	zf-C3HC4_2	18	55	0.23	12.0
TkA07G362590	`PF13445`	zf-RING_UBOX	19	55	0.017	15.8
TkA07G362590	`PF15227`	zf-C3HC4_4	19	55	0.26	12.1
TkA07G362590	`PF24768`	ARM_ARMC5	53	138	0.00021	21.5
TkA07G362590	`PF25598`	ARM_PUB	107	406	7.3e-58	197.1
TkA07G362590	`PF24768`	ARM_ARMC5	207	352	0.00021	21.5
TkA07G362590	`PF23216`	WHD_CYT4	207	248	0.058	14.3
TkA07G362590	`PF09744`	RH1	209	238	0.19	12.3
TkA07G362590	`PF09744`	RH1	283	324	0.19	12.3
TkA07G362590	`PF11789`	zf-Nse	390	401	0.0046	17.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXE3`	Arabidopsis thaliana	sp\|Q9LXE3\|PUB28_ARATH U-box domain-containing protein 28	45.100%	Swiss-Prot	Medium
`Q9LSA6`	Arabidopsis thaliana	sp\|Q9LSA6\|PUB29_ARATH U-box domain-containing protein 29	43.200%	Swiss-Prot	Medium
`Q9FLF4`	Arabidopsis thaliana	sp\|Q9FLF4\|PUB27_ARATH U-box domain-containing protein 27	41.300%	Swiss-Prot	Medium
`Q058P4`	Arabidopsis thaliana	sp\|Q058P4\|PUB30_ARATH U-box domain-containing protein 30	28.900%	Swiss-Prot	Low
`Q9FHN9`	Arabidopsis thaliana	sp\|Q9FHN9\|PUB31_ARATH U-box domain-containing protein 31	29.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card