TkA07G123120 | RubberDandelionOmics

Gene overview

TkA07G123120

Reference: TK1151 Chr: Chr07 Coordinates: 31927990-31930271 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1247 bp · TkA07G123120|TK1151|cDNA

TTCCGAATCACTTTTTGACGGTCAGCTCCCTCGTTGATTCATTAATCAGCCAACGAATACGAACTCCAAAATTTCATTTTCTTCTTCCTGGTGATTAAATCACACAGTTCGACGTGAAAGATGGGTTCGATTTTGATGTGGGTTTTACTTCTATCGGCCAGTTTCTTCAATTACGATGTCTCAGCTGATCAGATCTTCCCAACTCATGGAGGTAGCTTAAGTCGCAGCTCTCGTGAACCCAAATATGATATTGAATTCCA...

CDS

Download CDS FASTA

891 bp · TkA07G123120|TK1151|CDS

ATGGGTTCGATTTTGATGTGGGTTTTACTTCTATCGGCCAGTTTCTTCAATTACGATGTCTCAGCTGATCAGATCTTCCCAACTCATGGAGGTAGCTTAAGTCGCAGCTCTCGTGAACCCAAATATGATATTGAATTCCACACAGAAGATTCACCATTTCATCCTGATGATGATCAAGAATCGGTGGTGATGCCAAAGAAAAATGGAGAAAAGTTTCAATGTTTCTTACCAAAAGTGGAGAAAACCAAAAGTGAAAAGCA...

Protein

Download Protein FASTA

296 aa · TkA07G123120|TK1151|PROTEIN

MGSILMWVLLLSASFFNYDVSADQIFPTHGGSLSRSSREPKYDIEFHTEDSPFHPDDDQESVVMPKKNGEKFQCFLPKVEKTKSEKQTIQQNSTSLILETEKRFKLKTPDELLEALKDRCFLRQEGWWSYEFCYQKQLRQIHVEDEQVIQEFVLGEYDAEATAAYNHNLSDISTLKDPRSKDASQRYHAHQYTNGTTCDLTNEPRETEVRFVCSEPRAMISSITELSTCKYALTIQSPMLCKHPLFQEERPVWYTINCNP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G123120`
TK1151 ID	TkA07G123120
OH-1004 ID	LXL04_028104
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G123120

Location Chr07:31927990-31930271 (-)

Description Similar to OS9: Protein OS-9 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g35080`	Lectin which functions in endoplasmic reticulum (ER) quality control and ER-associated degradation (ERAD).	The Arabidopsis homolog of the mammalian OS-9 protein plays a key role in the endoplasmic reticulum-associated degradation of misfolded receptor-like kinases.2012 · DOI: 10.1093/mp/sss042

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0644800`	Lectin which functions in endoplasmic reticulum (ER) quality control and ER-associated degradation (ERAD).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028104 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006605 protein targeting Biological Process

GO:0006621 protein retention in ER lumen Biological Process

GO:0009651 response to salt stress Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030968 endoplasmic reticulum unfolded protein response Biological Process

GO:0030970 retrograde protein transport, ER to cytosol Biological Process

GO:0034976 response to endoplasmic reticulum stress Biological Process

GO:0036503 ERAD pathway Biological Process

GO:1904153 negative regulation of retrograde protein transport, ER to cytosol Biological Process

GO:0000836 Hrd1p ubiquitin ligase complex Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT5G35080

bta:504832

dosa:Os06g0644800

hsa:10956

mmu:216440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.442

Rank 1 · TkA07G123120 · TK1151

Golgi apparatus0.368

Rank 2 · TkA07G123120 · TK1151

Cytoplasm0.138

Rank 3 · TkA07G123120 · TK1151

Nucleus0.097

Rank 4 · TkA07G123120 · TK1151

Extracellular0.096

Rank 5 · TkA07G123120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07915PRKCSH79-79 aa

PF13015PRKCSH_179-249 aa

PF05026DCP299-138 aa

PF07915PRKCSH118-198 aa

PF13699eCIS_core157-200 aa

PF05026DCP2207-225 aa

PF05026DCP2245-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G123120	`PF07915`	PRKCSH	79	79	9.3e-19	68.8
TkA07G123120	`PF13015`	PRKCSH_1	79	249	6.5e-10	39.6
TkA07G123120	`PF05026`	DCP2	99	138	0.089	13.8
TkA07G123120	`PF07915`	PRKCSH	118	198	9.3e-19	68.8
TkA07G123120	`PF13699`	eCIS_core	157	200	0.067	14.1
TkA07G123120	`PF05026`	DCP2	207	225	0.089	13.8
TkA07G123120	`PF05026`	DCP2	245	254	0.089	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GWH3`	Arabidopsis thaliana	sp\|Q8GWH3\|OS9_ARATH Protein OS-9 homolog	60.100%	Swiss-Prot	High
`Q67WM9`	Oryza sativa subsp. japonica	sp\|Q67WM9\|OS9_ORYSJ Protein OS-9 homolog	56.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card