TkA07G002150 | RubberDandelionOmics

Gene overview

TkA07G002150

Reference: TK1151 Chr: Chr07 Coordinates: 548225-552147 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2230 bp · TkA07G002150|TK1151|cDNA

CTTTTATCGGTTTCCCACTTTCCCCACTACCAACTGCAAGTCTGCAACTTCCGAGGTCTGTAAACCTTCCAAGGTTTGAACTTGAAACCTCTTACGTATGAGGTGCTAAGCTTTACCAGTTGAGCACCGCCATAGTGACCGAGTATTATTTTCCTTCATCGCCTTTGAAGTGCATTTAATTTTGCCGTATGTAAATTTATGTTTCGACCGGAATAATCCCCAACTGTGACCGACTTTTAAACCTCGAGTGATCAGCTCAA...

CDS

Download CDS FASTA

1632 bp · TkA07G002150|TK1151|CDS

ATGTCAGAACTCTATGCGGCGGAGACGGCGACAACCGCCACCGTCAGATCACAGACGGAGTATATGAAGGGAAATGAGAAGAAGATTGTAGAAACGAACATAAACCAAGCTTGGGCATCTATTCAGACCGGAGTCTTCGATAATCCGTTGGTTTACACCCAAACCTGTACTACTTTAGGAAGCACTATCGATTCAGCTATCGCGACAAATGCAGTTCCATCATCATCTCATCTGCCTCAGCTACATTTGATTGTTAGAGA...

Protein

Download Protein FASTA

543 aa · TkA07G002150|TK1151|PROTEIN

MSELYAAETATTATVRSQTEYMKGNEKKIVETNINQAWASIQTGVFDNPLVYTQTCTTLGSTIDSAIATNAVPSSSHLPQLHLIVREVYRLMAELQQPSLMLLMLPIKAACKVGWFPDGVKADLLMMADKVCSMFSDTDKMRIEPSYVHSCVPNIILRFYPTMKVETILTSFNVKAGYGTFVVDFHISQGTLPRQCRNLWLLVARMDNMETAACIASPSNVNFLINGSEVPRRTKSNMGKGPQLPSNVTKMIKYGVNLLQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G002150`
TK1151 ID	TkA07G002150
OH-1004 ID	LXL04_026691
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.700
Protein coverage (%)	TK1151 99.816 / OH-1004 93.601 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G002150

Location Chr07:548225-552147 (+)

Description Similar to PIAL2: E4 SUMO-protein ligase PIAL2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g41580`	Together with MOM1 and PIAL1, regulates transcriptional gene silencing (TGS) independently of changes in DNA methylation.	Arabidopsis PIAL1 and 2 promote SUMO chain formation as E4-type SUMO ligases and are involved in stress responses and sulfur metabolism.2014 · DOI: 10.1105/tpc.114.131300 The SUMO E3 Ligase-Like Proteins PIAL1 and PIAL2 Interact with MOM1 and Form a Novel Complex Required for Transcriptional Silencing.2016 · DOI: 10.1105/tpc.15.00997
`At1g08910`	Together with MOM1 and PIAL2, regulates transcriptional gene silencing (TGS) independently of changes in DNA methylation.	Arabidopsis PIAL1 and 2 promote SUMO chain formation as E4-type SUMO ligases and are involved in stress responses and sulfur metabolism.2014 · DOI: 10.1105/tpc.114.131300 The SUMO E3 Ligase-Like Proteins PIAL1 and PIAL2 Interact with MOM1 and Form a Novel Complex Required for Transcriptional Silencing.2016 · DOI: 10.1105/tpc.15.00997

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026691 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000082 G1/S transition of mitotic cell cycle Biological Process

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0007259 cell surface receptor signaling pathway via JAK-STAT Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0016925 protein sumoylation Biological Process

GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0032480 negative regulation of type I interferon production Biological Process

GO:0033235 positive regulation of protein sumoylation Biological Process

KEGG gene cross-reference

ath:AT1G08910

ath:AT5G41580

dre:406712

hsa:8554

sce:YOR156C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.656

Rank 1 · TkA07G002150 · TK1151

Cytoplasm0.379

Rank 2 · TkA07G002150 · TK1151

Cell membrane0.041

Rank 3 · TkA07G002150 · TK1151

Mitochondrion0.031

Rank 4 · TkA07G002150 · TK1151

Endoplasmic reticulum0.026

Rank 5 · TkA07G002150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26716PIAL1_N30-177 aa

PF26716PIAL1_N183-212 aa

PF11789zf-Nse308-358 aa

PF02891zf-MIZ311-360 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G002150	`PF26716`	PIAL1_N	30	177	2.8e-40	138.3
TkA07G002150	`PF26716`	PIAL1_N	183	212	2.8e-40	138.3
TkA07G002150	`PF11789`	zf-Nse	308	358	3.4e-05	24.3
TkA07G002150	`PF02891`	zf-MIZ	311	360	1.7e-20	73.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JYG0`	Arabidopsis thaliana	sp\|F4JYG0\|PIAL2_ARATH E4 SUMO-protein ligase PIAL2	40.900%	Swiss-Prot	Medium
`A0A0A7EPL0`	Arabidopsis thaliana	sp\|A0A0A7EPL0\|PIAL1_ARATH E4 SUMO-protein ligase PIAL1	39.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card