TkA06G385640 | RubberDandelionOmics

Gene overview

TkA06G385640

Reference: TK1151 Chr: Chr06 Coordinates: 95425505-95429292 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1948 bp · TkA06G385640|TK1151|cDNA

TTCATCGATCAAAAACTTCAAAGACTTGTTTTATTTTGCCCTAACCCCTTTTCTTCATCAATTCATTCGTCCCCCACCGTCTCTCATTAATTCATTCGCACAATTCCGTTTCCTTTCATCAAATGCATCTGCTTGCTATTTAGGGTTACCATTGTTCACAGAAGGAATCGAGCGACGATCGTGGGTTTCCACGCTGTGAGATTCGTTGGTGATCTAGGGGAAACAGATGCAACTCGAAGCCTGCTTTGCTTTCCAGCGAT...

CDS

Download CDS FASTA

897 bp · TkA06G385640|TK1151|CDS

ATGATGTTCATGAATCAACCGAGGATCATGGTCATGAGTCATGGCGGACTGATTTCTCAACGTCGAGCTTCGGAAGACGTCTTTTTGTCGTCACTGGATTTTGTATTCCTTTGTTCTCTGCCACAAATTCAGGCTAGAAATCAGAAGGTAGGGGAACCGCCACTTCTTTCATTTTCCACTTTCTTACAAGCAGCCCGCAACAACATGATTCTTGTTGTTCCAGCACTTCTTTATGCTATCAATAACTACTTAAAGTTCAT...

Protein

Download Protein FASTA

298 aa · TkA06G385640|TK1151|PROTEIN

MMFMNQPRIMVMSHGGLISQRRASEDVFLSSLDFVFLCSLPQIQARNQKVGEPPLLSFSTFLQAARNNMILVVPALLYAINNYLKFIMQLYFNPATVKMLSNLKVLVVAILLSIIMKRRFSVIQWEALALLLFGINITQMQALPKDSSGIDVPVAMGAYIYTFVFVTVPSLASVFNEYALKSQYDTSIYLQNLFLYGYGAIFNFFGILGTVVLKGPESFDILRGHSKATMLLIINNAREGILSSFFLQICSYNFEKVFVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G385640`
TK1151 ID	TkA06G385640
OH-1004 ID	LXL04_009859
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	93.800
Protein coverage (%)	TK1151 76.174 / OH-1004 99.127 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G385640

Location Chr06:95425505-95429292 (+)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43240`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release
`At3g59360`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0604300`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release
`UniProt: Q7X7C4`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release
`UniProt: Q01IU9`	Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009859 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015739 sialic acid transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015136 sialic acid transmembrane transporter activity Molecular Function

GO:0015165 pyrimidine nucleotide-sugar transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G43240

ath:AT3G59360

dosa:Os02g0604300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.515

Rank 1 · TkA06G385640 · TK1151

Endoplasmic reticulum0.382

Rank 2 · TkA06G385640 · TK1151

Cytoplasm0.098

Rank 3 · TkA06G385640 · TK1151

Nucleus0.065

Rank 4 · TkA06G385640 · TK1151

Cell membrane0.052

Rank 5 · TkA06G385640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04142Nuc_sug_transp59-248 aa

PF00892EamA70-135 aa

PF17126RsmF_methylt_CI82-121 aa

PF20664DUF6814123-185 aa

PF00892EamA185-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G385640	`PF04142`	Nuc_sug_transp	59	248	9.1e-20	71.7
TkA06G385640	`PF00892`	EamA	70	135	0.0014	19.6
TkA06G385640	`PF17126`	RsmF_methylt_CI	82	121	0.15	12.7
TkA06G385640	`PF20664`	DUF6814	123	185	0.063	14.2
TkA06G385640	`PF00892`	EamA	185	185	0.0014	19.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GY97`	Arabidopsis thaliana	sp\|Q8GY97\|CSTR2_ARATH CMP-sialic acid transporter 2	76.200%	Swiss-Prot	High
`Q9C5H6`	Arabidopsis thaliana	sp\|Q9C5H6\|CSTR3_ARATH CMP-sialic acid transporter 3	74.800%	Swiss-Prot	High
`Q6K8S7`	Oryza sativa subsp. japonica	sp\|Q6K8S7\|CSTR5_ORYSJ CMP-sialic acid transporter 5	74.800%	Swiss-Prot	High
`Q7X7C4`	Oryza sativa subsp. japonica	sp\|Q7X7C4\|CSTR4_ORYSJ CMP-sialic acid transporter 4	73.400%	Swiss-Prot	High
`Q01IU9`	Oryza sativa subsp. indica	sp\|Q01IU9\|CSTR4_ORYSI CMP-sialic acid transporter 4	72.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card