TkA06G210030 | RubberDandelionOmics

Gene overview

TkA06G210030

Reference: TK1151 Chr: Chr06 Coordinates: 54449487-54451809 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1569 bp · TkA06G210030|TK1151|cDNA

CACCAGTCATGAAAAACGACCCACCGGAGCCAGAAAAAAACTTCAATTAATCAGACAATTTACCTTCAGCATAACCTACTTTCCCGTATTGTGATTGCTCCCTTTGTGCATAATCTTTTTGATGGCAGTTGCTTCCCTTCCGTCGTTCAATTTGACTCTTAAAGCTTCACCACTCTCGTTTGGATTGATATCGTCGGGAGCAAGCATATCGTTAGTTCGTCTTATGCTAAGTTTGGATCATTGAAGAAGAATCGAGATGT...

CDS

Download CDS FASTA

705 bp · TkA06G210030|TK1151|CDS

ATGGTACTTGAAAACATTGGGACCTCAGTTCTCGTATCCGAAAATCAGCTTTCAGAACTCCATCAGTTAATGGTGCAGTCAGCAAAAGCTCTGAAAATCGAACCTCCTGATCTATACGTGAGGCAAAGTCCTGTCCCTAATGCATACACTTTAGCCATTAATGGCAAAAAACCATTCGTTGTTGTTCATACAAGTCTCATAGAGCTTCTTTCAAGAAAGGAGTTGCAGGCTGTTTTGGCTCATGAACTTGGACACCTTAA...

Protein

Download Protein FASTA

234 aa · TkA06G210030|TK1151|PROTEIN

MVLENIGTSVLVSENQLSELHQLMVQSAKALKIEPPDLYVRQSPVPNAYTLAINGKKPFVVVHTSLIELLSRKELQAVLAHELGHLKCDHGVWLTVANILTLGAYTIPGIGGMIAERLEEQLFRWLRAAELTCDRAALIVVQDPKVVISVLMKLAGGCPSLADQLNVDAFLEQARSYDKASASPVGWYIRNAQTRQLSHPLPVLRAREIDEWSRSQDYKSLMKRAISTSSLKEA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G210030`
TK1151 ID	TkA06G210030
OH-1004 ID	LXL04_023835
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 67.630 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G210030

Location Chr06:54449487-54451809 (+)

Description Similar to htpX2: Protease HtpX homolog 2 (Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g27110`	Metalloendopeptidase with a Zn-dependent proteolytic activity and substrate cleavage upstream of hydrophobic residues.	The Plastoglobule-Localized Metallopeptidase PGM48 Is a Positive Regulator of Senescence in Arabidopsis thaliana.2016 · DOI: 10.1105/tpc.16.00745 Functions and substrates of plastoglobule-localized metallopeptidase PGM48.2017 · DOI: 10.1080/15592324.2017.1331197

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023835 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0010150 leaf senescence Biological Process

GO:0071586 CAAX-box protein processing Biological Process

GO:1900055 regulation of leaf senescence Biological Process

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0004222 metalloendopeptidase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G27110

mac:MA_2111

mma:MM_3134

mta:Moth_0714

tte:TTE1794

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.333

Rank 1 · TkA06G210030 · TK1151

Mitochondrion0.265

Rank 2 · TkA06G210030 · TK1151

Nucleus0.169

Rank 3 · TkA06G210030 · TK1151

Cell membrane0.131

Rank 4 · TkA06G210030 · TK1151

Peroxisome0.118

Rank 5 · TkA06G210030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01435Peptidase_M4818-212 aa

PF05569Peptidase_M5656-93 aa

PF10263SprT-like60-87 aa

PF06114Peptidase_M7870-91 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G210030	`PF01435`	Peptidase_M48	18	212	3.1e-19	70.2
TkA06G210030	`PF05569`	Peptidase_M56	56	93	0.0074	16.2
TkA06G210030	`PF10263`	SprT-like	60	87	0.098	13.3
TkA06G210030	`PF06114`	Peptidase_M78	70	91	0.23	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSC4`	Arabidopsis thaliana	sp\|Q9LSC4\|PGM48_ARATH Plastoglobule-localized metallopeptidase 48, chloroplastic	84.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card