TkA03G444990 | RubberDandelionOmics

Gene overview

TkA03G444990

Reference: TK1151 Chr: Chr03 Coordinates: 110919317-110928427 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1856 bp · TkA03G444990|TK1151|cDNA

ATTCTCTTATTAACCGAACGCAATAACCATGTTTAGTATTTAATTCTCCTATAAACCGACCCTTAACTCATAGAAGAGAGCATCCCAAAACCACTCCATTTTCTCAGGAACGTTGAGTTTCACTGAAACCGAAACAATGGCTCTTTTGTTGTATGCTACCTCCTTGATAATCCTAGTCATCTTTCTCATTAAACTCTACAACTTTACTCAACCCAAGAAAAACTTACCACCATCACCACCAAAACTGCCGGTGATCGGCA...

CDS

Download CDS FASTA

1515 bp · TkA03G444990|TK1151|CDS

ATGGCTCTTTTGTTGTATGCTACCTCCTTGATAATCCTAGTCATCTTTCTCATTAAACTCTACAACTTTACTCAACCCAAGAAAAACTTACCACCATCACCACCAAAACTGCCGGTGATCGGCAACCTCCACCAAATCAGCCCACTCCTCCACCACTCACTCCATTCATTATCCCAACGCCACGGTGGTCCGCTCATGCTCATCCACCTGGGCTCCGTCCCAACCCTGGTGGTATCATCAGCCGAAGCCGCCTCCGAGAT...

Protein

Download Protein FASTA

504 aa · TkA03G444990|TK1151|PROTEIN

MALLLYATSLIILVIFLIKLYNFTQPKKNLPPSPPKLPVIGNLHQISPLLHHSLHSLSQRHGGPLMLIHLGSVPTLVVSSAEAASEIMKTQDLLFANRPEVKMWRKLLCDLKEVSVAPYGEYWRQVKSIMVLHFLSNKRVEASGEVRDEEIEFAVRKIEKSCNQVVDLSDLFVTITNDVVCRLTFGRKYSEGESGRKFKNMLREFFELLGGLNLEDLIPVLAWVDRLRGFNARVERVAREVDEFLEGVVEERLKKRSEGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G444990`
TK1151 ID	TkA03G444990
OH-1004 ID	LXL04_009519
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G444990

Location Chr03:110919317-110928427 (+)

Description Similar to CYP736A117: Cytochrome P450 736A117

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30750`	Converts indole-3-acetaldoxime to indole cyanohydrin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009519 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016114 terpenoid biosynthetic process Biological Process

GO:0051762 sesquiterpene biosynthetic process Biological Process

GO:0016020 membrane Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function

GO:0016712 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen Molecular Function

GO:0020037 heme binding Molecular Function

GO:0102627 parthenolide 3beta-hydroxylase activity Molecular Function

GO:0102628 costunolide 3beta-hydroxylase activity Molecular Function

GO:0102876 psoralen synthase (NADPH) activity Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.933

Rank 1 · TkA03G444990 · TK1151

Cell membrane0.036

Rank 2 · TkA03G444990 · TK1151

Cytoplasm0.034

Rank 3 · TkA03G444990 · TK1151

Plastid0.025

Rank 4 · TkA03G444990 · TK1151

Golgi apparatus0.023

Rank 5 · TkA03G444990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45031-490 aa

PF11608RRM_MARF150-89 aa

PF15813DUF4708100-159 aa

PF11608RRM_MARF1239-270 aa

PF11608RRM_MARF1377-406 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G444990	`PF00067`	p450	31	490	3.5e-104	349.9
TkA03G444990	`PF11608`	RRM_MARF1	50	89	0.28	12.1
TkA03G444990	`PF15813`	DUF4708	100	159	0.092	12.7
TkA03G444990	`PF11608`	RRM_MARF1	239	270	0.28	12.1
TkA03G444990	`PF11608`	RRM_MARF1	377	406	0.28	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49340`	Arabidopsis thaliana	sp\|O49340\|C71AC_ARATH Cytochrome P450 71A12	45.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card