TkA03G042310 | RubberDandelionOmics

Gene overview

TkA03G042310

Reference: TK1151 Chr: Chr03 Coordinates: 11161675-11164290 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2577 bp · TkA03G042310|TK1151|cDNA

ATGTTCATCACCTTCCCATTACCACTCTTCTCTTTGCTCCTCCTCTCCACCGCCACCGCCCAACCATACAAACCCACCGACCACTTCCTACTCAATTGCGGCGGTGCAACTGTCACTTCCGATCGGAAATGGGACACCGACATACGTTCAAAATTCTTACCCACCACCACCACCTCCTTCATCTCCACCGCCAACCGCCCCAATCCCTCCGTCCCACAAATCCCGTACACCACCGCTCGAATCTTCAACACGTCATCATC...

CDS

Download CDS FASTA

2577 bp · TkA03G042310|TK1151|CDS

ATGTTCATCACCTTCCCATTACCACTCTTCTCTTTGCTCCTCCTCTCCACCGCCACCGCCCAACCATACAAACCCACCGACCACTTCCTACTCAATTGCGGCGGTGCAACTGTCACTTCCGATCGGAAATGGGACACCGACATACGTTCAAAATTCTTACCCACCACCACCACCTCCTTCATCTCCACCGCCAACCGCCCCAATCCCTCCGTCCCACAAATCCCGTACACCACCGCTCGAATCTTCAACACGTCATCATC...

Protein

Download Protein FASTA

858 aa · TkA03G042310|TK1151|PROTEIN

MFITFPLPLFSLLLLSTATAQPYKPTDHFLLNCGGATVTSDRKWDTDIRSKFLPTTTTSFISTANRPNPSVPQIPYTTARIFNTSSSTYTFPATTGPKFLRLYFYPAAYSDHNPNQSFFSVSSNGHSLLSNFSAFLTSSYLGTESNPLPYFVKEFVVYVNDTQTLTITFIPSPNSYAFINGIEIVSLPENLYNKSEGLKYVGLTSGAVITEDTTLENMYRLNVGGGQISPTNDTGMDRSWDQDDGYLISTIGLTPVNKTP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G042310`
TK1151 ID	TkA03G042310
OH-1004 ID	LXL04_006496
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 91.684 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G042310

Location Chr03:11161675-11164290 (-)

Description Similar to FER: Receptor-like protein kinase FERONIA

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51550`	May regulate MLO7 polarization in female gametophyte synergid cells to control pollen tube growth and male gamete delivery during fertilization.	FERONIA receptor-like kinase regulates RHO GTPase signaling of root hair development.2010 · DOI: 10.1073/pnas.1005366107
`At5g39000`	Putative receptor-like protein kinase At5g39000.	No verified direct reference in this release
`At5g38990`	Probable receptor-like protein kinase At5g38990.	No verified direct reference in this release
`At5g28680`	Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell.	No verified direct reference in this release
`At3g04690`	Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006496 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009723 response to ethylene Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010038 response to metal ion Biological Process

GO:0010118 stomatal movement Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0030308 negative regulation of cell growth Biological Process

GO:0032922 circadian regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT3G04690

ath:AT3G51550

ath:AT5G28680

ath:AT5G38990

ath:AT5G39000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.779

Rank 1 · TkA03G042310 · TK1151

Endoplasmic reticulum0.100

Rank 2 · TkA03G042310 · TK1151

Cytoplasm0.086

Rank 3 · TkA03G042310 · TK1151

Lysosome / Vacuole0.062

Rank 4 · TkA03G042310 · TK1151

Nucleus0.045

Rank 5 · TkA03G042310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11721Malectin31-182 aa

PF12819Malectin_like39-397 aa

PF11721Malectin262-344 aa

PF00069Pkinase265-292 aa

PF21314TM_ErbB1434-453 aa

PF00069Pkinase481-750 aa

PF07714PK_Tyr_Ser-Thr485-750 aa

PF01636APH597-632 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G042310	`PF11721`	Malectin	31	182	1.1e-09	39.3
TkA03G042310	`PF12819`	Malectin_like	39	397	1.1e-27	97.9
TkA03G042310	`PF11721`	Malectin	262	344	1.1e-09	39.3
TkA03G042310	`PF00069`	Pkinase	265	292	6.6e-49	167.4
TkA03G042310	`PF21314`	TM_ErbB1	434	453	0.27	11.7
TkA03G042310	`PF00069`	Pkinase	481	750	6.6e-49	167.4
TkA03G042310	`PF07714`	PK_Tyr_Ser-Thr	485	750	1.8e-48	165.8
TkA03G042310	`PF01636`	APH	597	632	0.027	15.0
TkA03G042310	`PF11721`	Malectin	815	846	1.1e-09	39.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCZ4`	Arabidopsis thaliana	sp\|Q9SCZ4\|FERON_ARATH Receptor-like protein kinase FERONIA	49.500%	Swiss-Prot	Medium
`Q9FID8`	Arabidopsis thaliana	sp\|Q9FID8\|Y5900_ARATH Putative receptor-like protein kinase At5g39000	46.900%	Swiss-Prot	Medium
`Q9FID9`	Arabidopsis thaliana	sp\|Q9FID9\|Y5389_ARATH Probable receptor-like protein kinase At5g38990	45.500%	Swiss-Prot	Medium
`Q3E8W4`	Arabidopsis thaliana	sp\|Q3E8W4\|ANX2_ARATH Receptor-like protein kinase ANXUR2	45.600%	Swiss-Prot	Medium
`Q9SR05`	Arabidopsis thaliana	sp\|Q9SR05\|ANX1_ARATH Receptor-like protein kinase ANXUR1	45.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card