Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2068 bp · TkA01G586520|TK1151|cDNA
TGATACTCCAAAGTAATTAAAAGATAAAGAGTAACTATTTTTATAAAGATTTTATACGCGATTTTTGGTTCCATTATCTTTCAATTTACCCGTTTCGATCAGATGGAGCAGAGAGTTCGGTCTATCTCACGCAAACAAAAATCAAGCGATAAACTTGAGGAATCAAATTACCCCTAAAGTCAAACAGAAGAATCTTCTAGTCATCCTTCATTCACTTATCATCCCCTTCGCTCACTACCAAATATCAAAGCGGTTGCTCA...
1194 bp · TkA01G586520|TK1151|CDS
TTGGGTCCATTATCTTTCAATTTTCCCGTTTCCATCGGATTGAGCAGAGATTTCGGCATATCTCACGTAAACAAAAATCAAGTGATAAACTTGAGGAATCAAATTACCCCTAAAGTCAAACAGAATAAATCTTCTGATCATCCATCGTTCTTCGCTCACTGCCAAAAACCAAAGCGGTTGCTCAGAAAACAAGATCGGTGGGTGAATATGGCTGAAAATTTGATGAATGCTGTTTGGTACAATTCTTATGGTGGAGGTTC...
Protein
Download Protein FASTA397 aa · TkA01G586520|TK1151|PROTEIN
LGPLSFNFPVSIGLSRDFGISHVNKNQVINLRNQITPKVKQNKSSDHPSFFAHCQKPKRLLRKQDRWVNMAENLMNAVWYNSYGGGSAGLKHVEIPVPSPTADEILLKVEAASINPIDWKFQKGMMRPFMPKKFPFIPVGDVAGEIVEVGSGVKNFKVGDKIISTLGVAGGGFAEYAVAKATSTVPRPPEVLAPDGVSLVIAGGTAFHALTVTGGIKLDKTEPQSHILVTAASGGVGHYAVQLAKLGNTHVTATCGGRNM...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G586520 |
|---|---|
| TK1151 ID | TkA01G586520 |
| OH-1004 ID | LXL04_000808 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 82.400 |
| Protein coverage (%) | TK1151 95.466 / OH-1004 52.445Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G586520 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:147515462-147521889 (-) | |||||||||
| Description | Similar to CEQORH: Chloroplast envelope quinone oxidoreductase homolog | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000325 plant-type vacuole Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0009706 chloroplast inner membrane Cellular Component GO:0009707 chloroplast outer membrane Cellular Component GO:0009941 chloroplast envelope Cellular Component GO:0003960 quinone reductase (NADPH) activity Molecular Function GO:0016491 oxidoreductase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT4G13010 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF16884ADH_N_292-169 aaPF08240ADH_N102-188 aaPF00107ADH_zinc_N182-202 aaPF00107ADH_zinc_N235-298 aaPF13602ADH_zinc_N_2266-395 aaPF16884ADH_N_2382-394 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G586520 | PF16884 | ADH_N_2 | 92 | 169 | 0.023 | 15.3 |
| TkA01G586520 | PF08240 | ADH_N | 102 | 188 | 2.9e-18 | 66.8 |
| TkA01G586520 | PF00107 | ADH_zinc_N | 182 | 202 | 3e-10 | 40.9 |
| TkA01G586520 | PF00107 | ADH_zinc_N | 235 | 298 | 3e-10 | 40.9 |
| TkA01G586520 | PF13602 | ADH_zinc_N_2 | 266 | 395 | 2.5e-19 | 71.2 |
| TkA01G586520 | PF16884 | ADH_N_2 | 382 | 394 | 0.023 | 15.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.