LXL04_038673 | RubberDandelionOmics

Gene overview

LXL04_038673

Reference: OH-1004 Chr: Chr09 Coordinates: 47881830-47884790 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2025 bp · LXL04_038673|LXL04_038673|OH1004|cDNA

ATGCAAAATGGTAACCTTGAGCCAGACTGGGCCGGTCATGGCCTGGATAAAATTGCTCTTATGCTATGTGGGCAATTGGGCATTACTTTGAAGCTAGGCTATGGTTGGTGGCCGCCAATCGATTGGCGCATCAACGAAAACATGTCAAACACCACCACCACAAAAGACGATGAATATGGAGTCCTATTATACTACAActacaccaaaatcccaaaTCTCAACGACCTATTCACCTTCTACAACACCAACTGcacctccct...

CDS

Download CDS FASTA

2025 bp · LXL04_038673|LXL04_038673|OH1004|CDS

ATGCAAAATGGTAACCTTGAGCCAGACTGGGCCGGTCATGGCCTGGATAAAATTGCTCTTATGCTATGTGGGCAATTGGGCATTACTTTGAAGCTAGGCTATGGTTGGTGGCCGCCAATCGATTGGCGCATCAACGAAAACATGTCAAACACCACCACCACAAAAGACGATGAATATGGAGTCCTATTATACTACAACTACACCAAAATCCCAAATCTCAACGACCTATTCACCTTCTACAACACCAACTGCACCTCCCT...

Protein

Download Protein FASTA

674 aa · LXL04_038673|LXL04_038673|OH1004|PROTEIN

MQNGNLEPDWAGHGLDKIALMLCGQLGITLKLGYGWWPPIDWRINENMSNTTTTKDDEYGVLLYYNYTKIPNLNDLFTFYNTNCTSLSLLGRIRLSPHGVNATIGGQPSSLKQHITALTSTYPSFTSTDFKLATSKIHPINNKTAQETGFTSLSIRIVKELVTFTSHHPPEIPISNAGQHLSAREFHSVLESAHPENLVLLDARNLYETRIGKFSPPNVETLDPKIRQYSDLSSWVDNNTEKIRGKKILMYCTGGIRCEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038673`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038673

Location Chr09:47881830-47884790 (-)

Description Similar to STR6: Rhodanese-like domain-containing protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09280`	Rhodanese-like domain-containing protein 6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038673 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006400 tRNA modification Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G09280

cjk:jk0240

hsa:158427

mmu:272027

pon:100172136

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.512

Rank 1 · LXL04_038673 · OH-1004

Nucleus0.484

Rank 2 · LXL04_038673 · OH-1004

Mitochondrion0.112

Rank 3 · LXL04_038673 · OH-1004

Plastid0.061

Rank 4 · LXL04_038673 · OH-1004

Peroxisome0.045

Rank 5 · LXL04_038673 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17773.8UPF0176_N59-160 aa

PF12368.14Rhodanese_C296-360 aa

PF03959.20FSH1374-585 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038673	`PF17773.8`	UPF0176_N	59	160	1.2e-14	55.1
LXL04_038673	`PF12368.14`	Rhodanese_C	296	360	1.2e-13	51.9
LXL04_038673	`PF03959.20`	FSH1	374	585	6.3e-40	137.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AC1`	Arabidopsis thaliana	Rhodanese-like domain-containing protein 6	59.298%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card