LXL04_036121 | RubberDandelionOmics

Gene overview

LXL04_036121

Reference: OH-1004 Chr: Chr08 Coordinates: 36059761-36064910 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1476 bp · LXL04_036121|LXL04_036121|OH1004|cDNA

atgaacttactagcttGGAAGGGGAAGAGCTTCAGATCTATTACGCTGAATCGTAATCTTCTAGGTCAAACTCAGCTCAAGAAGAAGAAGCGTGAATACCCGCAGCAGTTTGAAACACATCCATCCGCCTCCACAGACACACTCCCGTCTCCACTCTCCCGCTTGAGTCTCGACTGCTTCCATCGATTCGACCAGCAGTTCTCCATCCTCCATCCTCCATCGATCACCAGCAGTTCTCCTTCTTCTTCGGCTAATTTTCA...

CDS

Download CDS FASTA

1476 bp · LXL04_036121|LXL04_036121|OH1004|CDS

ATGAACTTACTAGCTTGGAAGGGGAAGAGCTTCAGATCTATTACGCTGAATCGTAATCTTCTAGGTCAAACTCAGCTCAAGAAGAAGAAGCGTGAATACCCGCAGCAGTTTGAAACACATCCATCCGCCTCCACAGACACACTCCCGTCTCCACTCTCCCGCTTGAGTCTCGACTGCTTCCATCGATTCGACCAGCAGTTCTCCATCCTCCATCCTCCATCGATCACCAGCAGTTCTCCTTCTTCTTCGGCTAATTTTCA...

Protein

Download Protein FASTA

491 aa · LXL04_036121|LXL04_036121|OH1004|PROTEIN

MNLLAWKGKSFRSITLNRNLLGQTQLKKKKREYPQQFETHPSASTDTLPSPLSRLSLDCFHRFDQQFSILHPPSITSSSPSSSANFQRFTTSRVTTSRPHQCSSESPTILRFHPHLRFHARTGAAPTILLQSSHGTGNMLRHGKNLTSPILHILVRRLPELQKEPTFRFASQWVKYASLSIQRLQAINLSSFTLTIIPLNGKSKAAISLSEALTNTESKPPLKIITETSFHLNRNQTYAEMTSEKNLRGVLRSEVDRQLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036121`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036121

Location Chr08:36059761-36064910 (-)

Description Similar to KTI12: Protein KTI12 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13870`	Elongator complex-associated factor that is not a structural subunit but rather transiently contacts the complex.	DRL1, a homolog of the yeast TOT4/KTI12 protein, has a function in meristem activity and organ growth in plants.2003 · DOI: 10.1105/tpc.007062 Transfer RNA modifications and genes for modifying enzymes in Arabidopsis thaliana.2010 · DOI: 10.1186/1471-2229-10-201 Comparative analysis of the conserved functions of Arabidopsis DRL1 and yeast KTI12.2015 · DOI: 10.14348/molcells.2015.2297

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0312782`	Elongator complex-associated factor that is not a structural subunit but rather transiently contacts the complex.	No verified direct reference in this release
`UniProt: B8BK80`	Elongator complex-associated factor that is not a structural subunit but rather transiently contacts the complex (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036121 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002098 tRNA wobble uridine modification Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006400 tRNA modification Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010449 root meristem growth Biological Process

GO:0048366 leaf development Biological Process

GO:0080178 5-carbamoylmethyl uridine residue modification Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0033588 elongator holoenzyme complex Cellular Component

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G13870

dosa:Os11g0312782

dre:751662

xla:735147

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.519

Rank 1 · LXL04_036121 · OH-1004

Cytoplasm0.425

Rank 2 · LXL04_036121 · OH-1004

Plastid0.098

Rank 3 · LXL04_036121 · OH-1004

Mitochondrion0.075

Rank 4 · LXL04_036121 · OH-1004

Peroxisome0.033

Rank 5 · LXL04_036121 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08433.17KTI12194-485 aa

PF13671.13AAA_33235-333 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036121	`PF08433.17`	KTI12	194	485	3.8e-68	230.7
LXL04_036121	`PF13671.13`	AAA_33	235	333	3.6e-07	31.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMH0`	Arabidopsis thaliana	Protein KTI12 homolog	65.529%	Swiss-Prot	moderate database homology
`B9GAG9`	Oryza sativa subsp. japonica	Protein KTI12 homolog	65.529%	Swiss-Prot	moderate database homology
`B8BK80`	Oryza sativa subsp. indica	Protein KTI12 homolog	65.529%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card