LXL04_031662 | RubberDandelionOmics

Gene overview

LXL04_031662

Reference: OH-1004 Chr: Chr07 Coordinates: 9308470-9309591 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

695 bp · LXL04_031662|LXL04_031662|OH1004|cDNA

CAAGAAATTATAAACATATGGATACCGAACCAAATGGAGGTGGCTCTTTGGTTCTAATAAAGCAAGGCGCTGAAGCTAGAGTCTTTGAGTCAACATTTGGTGGAAGAAAGTCTATCATCAAGGAACGATTCTCAAAGAAATACAGACATCCAACTTTAGATTCAAAGCTCACACTCAAGCGCTTAAATGCGGAAGCAAGGTGTATGACAAAAGCTAGAAAGCTTGGAGTTTCAACTCCCGTTCTTTATGCAGTCGACCCT...

CDS

Download CDS FASTA

678 bp · LXL04_031662|LXL04_031662|OH1004|CDS

ATGGATACCGAACCAAATGGAGGTGGCTCTTTGGTTCTAATAAAGCAAGGCGCTGAAGCTAGAGTCTTTGAGTCAACATTTGGTGGAAGAAAGTCTATCATCAAGGAACGATTCTCAAAGAAATACAGACATCCAACTTTAGATTCAAAGCTCACACTCAAGCGCTTAAATGCGGAAGCAAGGTGTATGACAAAAGCTAGAAAGCTTGGAGTTTCAACTCCCGTTCTTTATGCAGTCGACCCTGTATCACATACACTGAC...

Protein

Download Protein FASTA

225 aa · LXL04_031662|LXL04_031662|OH1004|PROTEIN

MDTEPNGGGSLVLIKQGAEARVFESTFGGRKSIIKERFSKKYRHPTLDSKLTLKRLNAEARCMTKARKLGVSTPVLYAVDPVSHTLTFEYIEGPSIKDIFLEFGSQGIIEEKMDDIAFQIGTTIGKLHDGGVIHGDLTTSNMLWRSDTNQLVLIDFGLSFVSTLPEDKGVDLYVLERALLSMHSSCGNVMDKILAGYRKSTKQWSSTFNKLGQVRLRGRKRTMVG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031662`
TK1151 ID	TkA08G121110
OH-1004 ID	LXL04_031662
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_031662`
Location	Chr07:9308470-9309591 (+)
Description	Similar to TP53RK: EKC/KEOPS complex subunit TP53RK
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031662` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002949 tRNA threonylcarbamoyladenosine modification Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006468 protein phosphorylation Biological Process GO:0008033 tRNA processing Biological Process GO:0043936 asexual sporulation resulting in formation of a cellular spore Biological Process GO:0070525 tRNA threonylcarbamoyladenosine metabolic process Biological Process GO:1990145 maintenance of translational fidelity Biological Process GO:0000408 EKC/KEOPS complex Cellular Component GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference	ani:ANIA_02513 ddi:DDB_G0279977 hsa:112858 spo:2541953 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.624

Rank 1 · LXL04_031662 · OH-1004

Nucleus0.287

Rank 2 · LXL04_031662 · OH-1004

Mitochondrion0.152

Rank 3 · LXL04_031662 · OH-1004

Plastid0.081

Rank 4 · LXL04_031662 · OH-1004

Peroxisome0.063

Rank 5 · LXL04_031662 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01163.29RIO124-157 aa

PF06293.21Kdo37-179 aa

PF00069.32Pkinase40-160 aa

PF07714.24PK_Tyr_Ser-Thr52-159 aa

PF03109.23ABC172-159 aa

PF01636.30APH129-161 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031662	`PF01163.29`	RIO1	24	157	2.4e-07	31.3
LXL04_031662	`PF06293.21`	Kdo	37	179	1.3e-07	32.0
LXL04_031662	`PF00069.32`	Pkinase	40	160	9.5e-11	42.3
LXL04_031662	`PF07714.24`	PK_Tyr_Ser-Thr	52	159	2e-06	28.1
LXL04_031662	`PF03109.23`	ABC1	72	159	9e-07	29.0
LXL04_031662	`PF01636.30`	APH	129	161	1.1e-06	29.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card