LXL04_029210 | RubberDandelionOmics

Gene overview

LXL04_029210

Reference: OH-1004 Chr: Chr06 Coordinates: 83810316-83820129 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5793 bp · LXL04_029210|LXL04_029210|OH1004|cDNA

ATGACGTCGAGAGGGGGAGGTAGTGGTCCTTCGGATCAATCCTCGCCGCAGCAGCGACGGATCATGCGGACACAGACAACAGGGAATCTCGGAGAGTCGCTATTTGATAGTGAAGTGGTGCCCTCGTCGTTGGTCGAGATTGCTCCTATCCTTCGTGTGGCTAATGAAGTCGAGCCTATCAACCTCAGGGTTGCTTATCTTTGTCGGTTATATGCATTTGAAAAAGCTCATTGTTTGGATCCCACTTCTAGTGGACGTGG...

CDS

Download CDS FASTA

5793 bp · LXL04_029210|LXL04_029210|OH1004|CDS

ATGACGTCGAGAGGGGGAGGTAGTGGTCCTTCGGATCAATCCTCGCCGCAGCAGCGACGGATCATGCGGACACAGACAACAGGGAATCTCGGAGAGTCGCTATTTGATAGTGAAGTGGTGCCCTCGTCGTTGGTCGAGATTGCTCCTATCCTTCGTGTGGCTAATGAAGTCGAGCCTATCAACCTCAGGGTTGCTTATCTTTGTCGGTTATATGCATTTGAAAAAGCTCATTGTTTGGATCCCACTTCTAGTGGACGTGG...

Protein

Download Protein FASTA

1930 aa · LXL04_029210|LXL04_029210|OH1004|PROTEIN

MTSRGGGSGPSDQSSPQQRRIMRTQTTGNLGESLFDSEVVPSSLVEIAPILRVANEVEPINLRVAYLCRLYAFEKAHCLDPTSSGRGVRQFKTALLQLLERENDPTLIMRMKKRDVREMQSFYRHYYLTYIQALQSAADKADRAQLTKAYQTANVLFEVLKAVNQTQCVEVDREILETHDKVAQKTEIYLPYNILPLDPDSANQAIMKYPEIRAAVVALRDTRGLPWPREYKKKSVEDILDWLQAMFGFQKDNVANQREH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029210`
TK1151 ID	TkA07G284880
OH-1004 ID	LXL04_029210
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 99.409 / OH-1004 95.907 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029210

Location Chr06:83810316-83820129 (-)

Description Similar to CALS3: Callose synthase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g13000`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At1g05570`	Involved in callose synthesis at the forming cell plate during cytokinesis.	An Arabidopsis Callose Synthase, GSL5, Is Required for Wound and Papillary Callose Formation.2003 · DOI: 10.1105/tpc.016097
`At2g31960`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At2g13680`	Required for the formation of the callose wall separating the tetraspores (interstitial wall) and surrounding the pollen mother cells (peripheral wall).	Callose synthase (CalS5) is required for exine formation during microgametogenesis and for pollen viability in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02379.x Callose (beta-1,3 glucan) is essential for Arabidopsis pollen wall patterning, but not tube growth.2005 · DOI: 10.1186/1471-2229-5-22
`At5g36870`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029210 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006075 (1->3)-beta-D-glucan biosynthetic process Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0009555 pollen development Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0071555 cell wall organization Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0000148 1,3-beta-D-glucan synthase complex Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G05570

ath:AT2G13680

ath:AT2G31960

ath:AT5G13000

ath:AT5G36870

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.643

Rank 1 · LXL04_029210 · OH-1004

Endoplasmic reticulum0.190

Rank 2 · LXL04_029210 · OH-1004

Cytoplasm0.111

Rank 3 · LXL04_029210 · OH-1004

Golgi apparatus0.097

Rank 4 · LXL04_029210 · OH-1004

Lysosome / Vacuole0.081

Rank 5 · LXL04_029210 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04652.22Vta147-175 aa

PF14288.12FKS1_dom1324-436 aa

PF25968.1CALS1846-1025 aa

PF02364.22Glucan_synthase1033-1736 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029210	`PF04652.22`	Vta1	47	175	2.8e-13	50.8
LXL04_029210	`PF14288.12`	FKS1_dom1	324	436	4.6e-42	143.5
LXL04_029210	`PF25968.1`	CALS1	846	1025	2.2e-62	210.7
LXL04_029210	`PF02364.22`	Glucan_synthase	1033	1736	4.1e-228	760.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXT9`	Arabidopsis thaliana	Callose synthase 3	74.580%	Swiss-Prot	strong database homology
`Q9AUE0`	Arabidopsis thaliana	Callose synthase 1	70.637%	Swiss-Prot	strong database homology
`Q9SL03`	Arabidopsis thaliana	Callose synthase 2	69.689%	Swiss-Prot	strong database homology
`Q3B724`	Arabidopsis thaliana	Callose synthase 5	57.752%	Swiss-Prot	strong database homology
`Q9LTG5`	Arabidopsis thaliana	Callose synthase 4	57.588%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card